Question

I 79) The sequence of a nonapeptide was determined from the following evidence: a. A peptide is acyclic compound containing a

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
I 79) The sequence of a nonapeptide was determined from the following evidence: a. A peptide...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Vasopressin, a nonapeptide hormone secreted by the pituitary gland, functions by stimulating the kidney to retain...

    Vasopressin, a nonapeptide hormone secreted by the pituitary gland, functions by stimulating the kidney to retain water. Its sequence was determined by the following evidence: 1. Vasopressin is a cyclic compound containing a disulfide bridge between two cysteine residues. 2. When the disulfide bridge is reduced, vasopressin has the constitution Arg, Asn, Cys2, Gln, Gly, Ile, Phe, Pro. 3. Partial hydrolysis of vasopressin yields seven fragments: Asp-Cys, Ile-Glu, Cys-Phe, Arg-Gly, Phe-Ile-Glu, Glu-Asp-Cys, Cys-Pro-Arg. 4. Gly is the C-terminal group. 5....

  • Vasopressin, a nonapeptide hormone secreted by the pituitary gland, functions by stimulating the kidney to retain...

    Vasopressin, a nonapeptide hormone secreted by the pituitary gland, functions by stimulating the kidney to retain water. Its sequence was determined by the following evidence: 1. Vasopressin is a cyclic compound containing a disulfide bridge between two cysteine residues. 2. When the disulfide bridge is reduced, vasopressin has the constitution Arg, Asn, Cys2, Gln, Gly, Ile, Phe, Pro. 3. Partial hydrolysis of vasopressin yields seven fragments: Asp-Cys, Ile-Glu, Cys-Phe, Arg-Gly, Phe-Ile-Glu, Glu-Asp-Cys, Cys-Pro-Arg. 4. Gly is the C-terminal group. 5....

  • PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction...

    PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...

  • On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments...

    On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments based on their molecular weights. Your fellow intern Jerry has neglected to label his tubes of amyloid beta peptide 42 after digesting them with some proteases that we learned about in Module 6: pepsin, trypsin, and chymotrypsin. Help him figure out what protease is in each tube. Jerry’s supervisor has the fragments listed in the same order as the original peptide primary sequence, which...

  • please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...

    please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...

  • On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments...

    On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments based on their molecular weights. Your fellow intern Jerry has neglected to label his tubes of amyloid beta peptide 42 after digesting them with some proteases that we learned about in Module 6: pepsin, trypsin, and chymotrypsin. Help him figure out what protease is in each tube. Jerry’s supervisor has the fragments listed in the same order as the original peptide primary sequence, which...

  • What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...

    What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...

  • Indicate which of the amino acid residues in the following peptide sequence contains a group that...

    Indicate which of the amino acid residues in the following peptide sequence contains a group that has a negative charge for its most likely charge state at pH 10. Glu-Cys-Tyr-Lys-Asp-Ile-Leu-His-Trp

  • 1. For the peptide, endothelin-3 calculate its molar extinction coefficient at 280nm (in an aqueous solution)....

    1. For the peptide, endothelin-3 calculate its molar extinction coefficient at 280nm (in an aqueous solution). Endothelin-3 Cys Thr Cys Phe Thr Tyr Lys Asp Lys Glu Cys Val Tyr Tyr Cys His Leu Asp Ile Ile Trp path length is 1cm (Disulfide bridge: 1-15; 3-11) What is peptide concentration, if the solution has an Abs280nm =0.275?

  • How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide?...

    How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide? Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT