Turing Machine Homework
(100p) Design a Turing machine that sums two binary numbers in the tape. You are expected to start writing the result from the left (in reverse, after numbers) and then reverse this result. The numbers should be entered with the pattern: #num1#num2#
For example, for input #101#110# The tape should first look like: #101#110#1101, Then you should reverse the result: #101#110#1011.
Use Turing Machine Visualization online tool https://turingmachine. io./ to create and trace your Turing Machine. Please, read descriptions and usage information on the website.
After you are done with your Turing Machine, click Share button and Download Document as a .yaml file, then upload this file on Moodle as your assignment.
Homework Answers
Request Answer!
10 have requested this problem solution
The more requests, the faster the answer.
Turing machine that subtracts two from the input string corresponding a ternary number.
Implement a Turing machine that subtracts two from the input string corresponding a ternary number. More specifically, suppose w = an−1an−2 . . . a1a0 is the input string with ai ∈ {0, 1, 2}. Your Turing machine should subtract two from w “in-place”, i.e., at the end of the computation the tape should contain the result, w − 2 and the tape head should be at the start of that string. Upon a successful operation, halt on accept. Otherwise,...
In C++ In this homework, you will be tasked with creating functions to manipulate strings that...
In C++ In this homework, you will be tasked with creating functions to manipulate strings that come from files and then outputting the strings to another file. All of these functions are housed together in a menu. The user will be asked to input a file name and then their menu selection. The menu is this: Get rid of white space Print amount of characters in the file Print amount of words in the file Replace all vowels with 3's...
Need help problem 9-13 C++ Homework please help WRITE FUNCTION PROTOTYPES for the following functions. The...
Need help problem 9-13
C++ Homework please help
WRITE FUNCTION PROTOTYPES for the following functions. The functions are described below on page 2. (Just write the prototypes) When necessary, use the variables declared below in maino. mm 1.) showMenu m2.) getChoice 3.) calcResult m.) showResult 5.) getInfo mm.) showName 7.) calcSquare 8.) ispositive int main { USE THESE VARIABLES, when needed, to write function prototypes (#1 - #8) double num1 = 1.5; double num2 = 2.5; char choice; double result;...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
**TStack.py below** # CMPT 145: Linear ADTs # Defines the Stack ADT # # A stack (also called a pushdown or LIFO stack)...
**TStack.py below**
# CMPT 145: Linear ADTs
# Defines the Stack ADT
#
# A stack (also called a pushdown or LIFO stack) is a compound
# data structure in which the data values are ordered according
# to the LIFO (last-in first-out) protocol.
#
# Implementation:
# This implementation was designed to point out when ADT operations are
# used incorrectly.
def create():
"""
Purpose
creates an empty stack
Return
an empty stack
"""
return '__Stack__',list()
def is_empty(stack):
"""...
Lab 19 - History of Computer Science, A File IO Lab FIRST PART OF CODING LAB:...
Lab 19 - History of Computer Science, A File IO Lab FIRST PART OF CODING LAB: Step 0 - Getting Starting In this program, we have two classes, FileIO.java and FileReader.java. FileIO.java will be our “driver” program or the main program that will bring the file reading and analysis together. FileReader.java will create the methods we use in FileIO.java to simply read in our file. Main in FileIO For this lab, main() is provided for you in FileIO.java and contains...
Programming Question
Exercise #2:Create a data file named water.dat with the following data: 123 134 122 128 111 110 98 99 78 98 100 120 122 110 111 123 134 122 128 111 110 98 99 78 98 100 120 122 110 111. Each number represents the number of millions of gallons of water provided to a major city over the period of one month. The data runs for quite a number of months. You will write a loop to read all the data...
Exercise #2: 10 M gals water per day 71-80 81-90 91-100 101-110 111-120 121-130 131-140 10...
Exercise #2: 10 M gals water per day 71-80 81-90 91-100 101-110 111-120 121-130 131-140 10 M gals water per day 71-80 91-100 101-110 111-120 121-130 131-140 Create a data file named water.dat with the following data: 123 134 122 128 111 110 98 99 78 98 100 120 122 110 111 123 134 122 128 111 110 98 99 78 98 100 120 122 110 111. Each number represents the number of millions of gallons of water provided to...
Question A matrix of dimensions m × n (an m-by-n matrix) is an ordered collection of m × n elemen...
Question A matrix of dimensions m × n (an m-by-n matrix) is an ordered collection of m × n elements. which are called eernents (or components). The elements of an (m × n)-dimensional matrix A are denoted as a,, where 1im and1 S, symbolically, written as, A-a(1,1) S (i.j) S(m, ). Written in the familiar notation: 01,1 am Gm,n A3×3matrix The horizontal and vertical lines of entries in a matrix are called rows and columns, respectively A matrix with the...
Need help problem 9-13
C++ Homework please help
WRITE FUNCTION PROTOTYPES for the following functions. The functions are described below on page 2. (Just write the prototypes) When necessary, use the variables declared below in maino. mm 1.) showMenu m2.) getChoice 3.) calcResult m.) showResult 5.) getInfo mm.) showName 7.) calcSquare 8.) ispositive int main { USE THESE VARIABLES, when needed, to write function prototypes (#1 - #8) double num1 = 1.5; double num2 = 2.5; char choice; double result;...
**TStack.py below**
# CMPT 145: Linear ADTs
# Defines the Stack ADT
#
# A stack (also called a pushdown or LIFO stack) is a compound
# data structure in which the data values are ordered according
# to the LIFO (last-in first-out) protocol.
#
# Implementation:
# This implementation was designed to point out when ADT operations are
# used incorrectly.
def create():
"""
Purpose
creates an empty stack
Return
an empty stack
"""
return '__Stack__',list()
def is_empty(stack):
"""...
Question A matrix of dimensions m × n (an m-by-n matrix) is an ordered collection of m × n elements. which are called eernents (or components). The elements of an (m × n)-dimensional matrix A are denoted as a,, where 1im and1 S, symbolically, written as, A-a(1,1) S (i.j) S(m, ). Written in the familiar notation: 01,1 am Gm,n A3×3matrix The horizontal and vertical lines of entries in a matrix are called rows and columns, respectively A matrix with the...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago