Question

Use BLAST to find DNA sequences in databases

1. Perform a BLAST search as follows:
   1. Do an Internet search for “ncbi blast”.
   2. Click on the link for the result: BLAST: Basic Local Alignment Search Tool.
   3. Under the heading “Basic BLAST,” click on “nucleotide blast”.

pMCT118_F   5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R   5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer)

1. 4. Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the search window)
   5. Omit any non-nucleotide characters from the window because they will not be recognized by the BLAST algorithm.
   6. Make sure the search window has only one long sequence of nucleotides with no spaces in between.
   7. Under “Choose Search Set” select “Nucleotide collection (nr/nt)”from the pull-down menu.
   8. Under “Program Selection” optimize for ”Somewhat similar sequences (blastn)”.
   1. Click on “BLAST”. This send your query sequences to a server at an NCBI. There, the BLAST algorithm will attempt to match the primer sequences to the DNA sequences stored in its database. A temporary page showing the status of your search will be displayed until your results are available. This may take only a few seconds or more than one minute if many other searches are queued at the server.
2. The results of the BLAST search are displayed in three ways as you scroll down the page:
   1. First, a Graphic Summary illustrates how significant matches or “hits” align with the query sequence. What do you notice about the lengths and colors of the matches (bars) as you look from the top to the bottom, e.g., what do these two different things mean? (4.5 pts)

2. Return to the results shown on the Descriptions tab. What is the E value of the most significant hits with 100% match to the query input sequence? (4.5 pts)

3. Note the species names of the other less significant hits. What do they all have in common, and what relationship do they have to the species matching to the most significant hits? (4.5 pts)

4. For the most significant hits, notice that there are different numbers of repeat units for each match. What is the range of repeat units in these different BLAST hits? (4.5 pts)

Answer 1

a) In the graphic summary, horizontal lines with different colours appeared in a sequence. Here the colours indicate the alignment scores while comparing the given sequence in different oranisms with green lines indicatiing alignment score of 50-80%, blue lines 40-50% and black lines less than 40%. Moreover the lengths of these lines and their positions indicate the segments of their sequence similarilty

b) E-Value of the most significant hits is 3e-05

c) The species names of less significant hits are Pan Troglodytes, Nicotiana Tabacum, Papio anubis, Gorilla gorilla etc. All these species have lower maximum score value and lower total score value than the species with most significant hits. Moreover, These species are related to the species with most significant hits in that their query cover matches to a great extent.

d) 13- 24 repeat units as is evident from the data