Question

x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homx Assignment 2 - Database searc... ... Question 1: In this problem we will explore the effect of a short protein query on thex Assignment 2 - Database searc... ... PNLHGLFGRKTG. By deiault, the parameters are adjusted for short queries. Inspect the o

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Note: Only the first four questions/parts can be answered at once. Therefore ( question 1- a,b and question2 a,b ) are answered properly.

Question 1:

A)

1) Homos sapiens - Human

€ → C .ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=info&id=9606&Ivl=3&lin=f&keep=1&srchmode=1&unlock 3 NCBI POSTAL Taxo2) Heterodoxus macropus - wallaby louse

+ → C ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=145266 3 NCBI POOL - Taxonomy Browser Nucleotide Protein as complete na3) E.Coli - E.Coli

→ C o ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=info&id=562&Ivl=3&lin=f&keep=1&srchmode=1&unlock 3 NCBI POST Taxonomy

Part B)

1) Homo Sapiens Nucleotides - 27613709

+ → C o ncbi.nlm.nih.gov/nucleotide?term=txid9606[Organism] 3 NCBI Resources How To Sign in to NCBI Nucleotide Nucleotide Sea

1) Homo Sapiens Proteins - 1380761

c n cbi.nlm.nih.gov/protein?term=txid9606[Organism] 3 NCBI Resources How To Sign in to NCBI Protein Protein txid9606[Organism2) Heterodoxus macropus Nucleotides - 02

f = c n cbi.nlm.nih.gov/nucleotide?term=txid 145266[Organism] 3 NCBI Resources How To Sign in to NCBI Nucleotide Nucleotide S2) Heterodoxus macropus Proteins - 26

c n cbi.nlm.nih.gov/protein?term=txid 145266[Organism] 3 NCBI Resources How To Sign in to NCBI Protein Protein txid 145266[Or3) E.Coli - Nucleotide - 7749435

€ → c n cbi.nlm.nih.gov/nucleotide?term=txid562[Organism] 2 NCBI Resources How To U Sign in to NCBI Nucleotide Nucleotide Sea3) E.Coli - Proteins - 57185393

→ cbi.nlm.nih.gov/protein?term=txid562[Organism] 3 NCBI Resources How To Sign in to NCBI Protein Protein txid562[Organism]||

Question 02:

a)

Scientific name of plague thrips -

 Thrips imaginis

c n cbi.nlm.nih.gov/nuccore/AF335993.2, ☆ ABPG 3 NCBI Resources How To Sign in to NCBI Nucleotide Nucleotide Search Advanced

b) We found 14 sequence records

f = c n cbi.nlm.nih.gov/nucleotide?term=txid159957[Organism] 3 NCBI Resources How To Sign in to NCBI Nucleotide Nucleotide Se

Add a comment
Know the answer?
Add Answer to:
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1:...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1:...

    x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...

  • : Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate...

    : Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate organism(s), and run many iterations until obtaining the hit of Electrophorus electricus. (revise with more limitation of information) Report for P04637.......: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate organism(s), and run many iterations until obtaining the hit of Electrophorus electricus. (revise with more limitation of information) Report for P04637 a. Locus name & gene name b....

  • Question 5: Use accession number “CU329670” to search the Nucleotide database. a. What is the type...

    Question 5: Use accession number “CU329670” to search the Nucleotide database. a. What is the type of sequence? What is the length of sequence? What is the name of database division? b. What is the scientific name of organism? Go to the FEATURES section of the record. Link to the CDS to gain access to the first 5662 nucleotides of the sequence. c. Name the protein product of the CDS and the length of protein. d. Write the first four...

  • For the next part of the assignment, you need to take the appropriate sequence below (based...

    For the next part of the assignment, you need to take the appropriate sequence below (based on the first letter of your last name), and use the nucleotide BLAST function on GenBank () to identify A) What gene was amplified B) From what organism the sequence came (scientific and common name), and C) in which Order that species is taxonomically placed https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch CTGTGACTTTGCCAAGTGGAGGTGTGTGCTGAAGATCTCAGACAGCTGCCCCACACCTCTTGCCATCGCAGAGAATGCCAACGTACTGGCCAGATATGCCAGCATTTGTCAACAGGTTGGCATCACCCACTCAATAGAAATGACACCCAATTTGCAAGTACTACAATGGCACTCAGTGAAATTTGAACAATGCTAATATGAATCAGCAGC

  • please answer questions with the following BLAST results For your GenBank assignment due at 12 noon on Thursday May...

    please answer questions with the following BLAST results For your GenBank assignment due at 12 noon on Thursday May 23rd (don't forget, I will not accept late papers): 1. Dr. Monsen-Collar will tell you the number of a sequence posted on Canvas. Copy the entire sequence and use it in a BLAST search to determine what gene the sequence is. Answer the following questions: A. What gene is your unknown sequence likely to be? How do you know it's a...

  • Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...

    Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F   5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R   5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...

  • Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an...

    Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an mRNA that can be translated. The gene organization is the order of the DNA segments that comprise the gene starting with the promoter, the first exon, the first intron, the second exon, and so on. The interspersed intrans can make gene identification difficult in eukaryotesparticularly in higher eukaryotes with many introns and alternative spliced mRNAs. Prediction of many genes and their organization has been...

  • We will refer to the protein as sequence2. It was just 40 amino acids long and...

    We will refer to the protein as sequence2. It was just 40 amino acids long and had the following amino acid sequence >sequence2 MSAEALADPAADPLAGNNPDADPEAINLKAIAALAKALLG Using your knowledge of BLAST searching particularly “Protein BLAST” (http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome), the Expasy (http://www.expasy.org/) and the BLASTP align2seq (http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LINK_LOC=align2seq ) Answer the following questions: a) What is the identity score between the query protein sequence (i.e. sequence2) and the highest scoring (best) aligning sequence from the BLAST search? (1 mark) b) Using similarity to other species as...

  • 5. Professor Clueless has just identified a novel sequence X that s VERY similar to sequence Y as shown by the alignment in Figure 16.2. On the other hand, when he uses blast to find homologs of X ag...

    5. Professor Clueless has just identified a novel sequence X that s VERY similar to sequence Y as shown by the alignment in Figure 16.2. On the other hand, when he uses blast to find homologs of X against genbank (Figure 16.3), he obtains VERY different results from a blastn with query sequence Y (Figure 16.4). With such similarity between X and Y, he was expecting the two queries to get very similar results. What advice will you give the...

  • Part I— Just Bad Luck? Brrrring! Brrrring! Jane checked the caller ID on her phone. “Sam!...

    Part I— Just Bad Luck? Brrrring! Brrrring! Jane checked the caller ID on her phone. “Sam! Great!” she thought. It was always nice to get a call from her older brother. But a little twinge of worry tugged at her. It was just a couple of weeks ago that he had mentioned making an appointment with his doctor about some abdominal pain he had been having. “Hi Sam! It’s great to hear from you,” Jane answered. “Hi Jane. Well I...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT