Question

3. Compare the key players in DNA replication, transcription, and translation by filling out a table such as this one (this i

0 0
Add a comment Improve this question Transcribed image text
Answer #1
Key Player Replication Transcription Translation
DNA components Sbstrate,template,primer and enzymes DNA template,enzymes mRNA,ribosome,tRNA,and aminoacyl - tRNA synthetase
RNA components RNA polymerase RNA polymerase, large and small subunits of ribosome,mRNA,tRNA
Protein components DNA helicases,SSB protein,pimase,both DNA and RNA polymerase reverse transcriptase,transcriptase mRNA,ribosome,tRNA, and aminoacyl - tRNA synthetase
Add a comment
Know the answer?
Add Answer to:
3. Compare the key players in DNA replication, transcription, and translation by filling out a table...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Identify the components of replication, transcription, and translation processes. Replication transcription translation DNA polymerase, deoxynucleoside triphosphate,...

    Identify the components of replication, transcription, and translation processes. Replication transcription translation DNA polymerase, deoxynucleoside triphosphate, primer, RNA polymerase, nucleoside triphosphate, transfer RNA, ribosome, messenger RNA , promoter, ribosomal RNA

  • The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...

    The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...

  • Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...

    Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

  • 1.4. In linear eukaryotic DNA, the replication of DNA ends is carried out by a) DNA...

    1.4. In linear eukaryotic DNA, the replication of DNA ends is carried out by a) DNA Poll b) DNA Pol III c) Telomerase d) DNA Gyrase 1.5. Based on what we know regarding gene expression, which of the following basic mechanisms of gene expression is most logical? a) DNA → RN → protein b) DNA → MRNA → protein c) mRNA → DNA → rRNA → protein d) DNA → cell [TURN OVER] 1.6. Which of the following processes does...

  • Question 2a If the DNA template 5′- ATGGATGC -3′ is transcribed to RNA, the RNA would...

    Question 2a If the DNA template 5′- ATGGATGC -3′ is transcribed to RNA, the RNA would be best described as... a. 3′- TACCTACG -5′. b. 5′- ATGGATGC -3′. c. 5′- AUGGAUGC -3′. d. 5′- UACCUACG -5′. e. 3′- UACCUACG -5′. Question 2b Which answer best summarizes how eukaryotic and bacterial RNA polymerases are different? a. Eukaryotes have several types of multimeric RNA polymerases, whereas bacteria only have one monomeric RNA polymerase. b. Eukaryotes have several types of RNA polymerases, one...

  • DNA mutations that change DNA sequence occur during: 1) replication O2) transcription 3) translation 4) protein...

    DNA mutations that change DNA sequence occur during: 1) replication O2) transcription 3) translation 4) protein synthesis A person has an adrenal tumor with increased secretion of aldosterone. They might develop secondary hypertension with an: 1) increase in potassium and blood volume O2) decrease in potassium and blood volume 3) increase in potassium and decrease in blood volume O4) decrease in potassium and increase in blood volume

  • A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication...

    A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication fork, DNA polymerase III, primase, and ligation. Make sure that your answer is complete and that all the entities that come together in the process of lagging strand replication are clearly explained. Draw one figure of a replication fork with the polarity (directionality) of each DNA strand indicated. G) Explain RNA transcription in E. coli in detail, from initiation to termination. Underline the following...

  • Can someone help me fill out this chart? Microbiology Fill in the table. (First row has...

    Can someone help me fill out this chart? Microbiology Fill in the table. (First row has been filled out as an example) Process Molecule made during the process Molecule which is the template for the process Replication DNA RNA Transcription Translation

  • where does transcription begin 3. List the major types of RNA and include what they code...

    where does transcription begin 3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT