Question

4:59 A The olm ENA The V Ames Than NA mRNA
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer-

According to the given question-

Translation- is formation of protein based on the information present in the mRNA.

  mRNA ----->> Protein

mRNA after the transcription moves out of the nucleus and enter the cytoplasm and act as template for protein synthesis. Enzyme aminoacyl tRNA synthetase has two binding sites. one recognizes methionine amino acid and binds with the ATP molecule and activate the amino acid called charged tRNA ans released from the aminoacyl tRNA synthetase enzyme and initiate the translation process.

Initiation- Small subunit of ribosome binds with the mRNA which contains codon and recognizes initiation codon AUG. at this point the tRNA that posses the anticodon UAC pairs with the AUG codon of mRNA after that large subunit of ribosomes combined with the small subunit of ribosomes. the large subunit have E site called exit site, P site or peptidyl site and A site or acceptor site and form the initiation complex.

Elongation- during elongation another molecule of tRNA carrying amino acid fits in the  A site of large subunit and peptide bond formation takes place between methionine and second amino acid at P site. after that the met tRNA become deaceylated and shift to E site and dissociates from E site. same time the ribosome unit moves one codon in right direction and at the same time another tRNA containing the amino acid comes at A site and peptide bond formation takes place and chain formation takes place at P site.

Termination- Occur when either release factor bind with the A site of termination codon or stop codon such as UGA, UAA, UAG is observed. after that the chain is released from the P site of ribosomes then tRNA, ribosomes large and small subunit also dissociates.

so based on the question -

mRNA reading frame are translated in the 5′→3direction into amino acids to form a polypeptide chain.

lets suppose the mRNA have sequence such as

3' AUGACUUUGAAUCGCACGCUAUAA 5'

Amino acid chain will be as   Met- Thr- Thr- Asn-Arg-Thr- Leu

1st Amino acid 2nd amino acid 3rd Amino acid 4th Amino acid
  Met Thr Thr Asn

Add a comment
Know the answer?
Add Answer to:
4:59 A The olm ENA The V Ames Than NA mRNA
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT