Question

UUU Phe UGA UCAS UAG CAU : CUCI First base (5 end) Table 1. The Genetic Code for All 20 Amino Acids Second base -A- -G- UCU
0 0
Add a comment Improve this question Transcribed image text
Answer #1

YA CCU CAUT HIS CUC First base (5 end) Table 1. The Genetic Code for A 20 Amino Acids Second base -U- -A- UUU Phe UCU UAU] T

Please rate high.

Add a comment
Know the answer?
Add Answer to:
UUU Phe UGA UCAS UAG CAU : CUCI First base (5' end) Table 1. The Genetic...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Use the genetic code table to answer the following question: Second Base First Base Third Base...

    Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...

  • Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...

    Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...

  • If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

    If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...

  • Please explain Refer to the figure of the genetic code shown below. What is the sequence...

    Please explain Refer to the figure of the genetic code shown below. What is the sequence of amino acids coded for by the following section of mRNA? UCUGAUGGGCUUU Second Base UGU UuC UGC UUA UAA Stop UGA StopA UAG Stop UGG TrpG CUU CUc CUA CUG CGA AUC lle ACC AUA AUG Met or Start ACG GAU GAC GAA GAG GGU GGC GGA Val GUA

  • The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the...

    The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...

  • Question 24 Refer to the table below to answer the following question. А G U Serine...

    Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...

  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

    Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...

  • To Do Exit 1:00:32 41697 m 2 1:59 PN 68. -33761 5 Que at 11:5 1.5...

    To Do Exit 1:00:32 41697 m 2 1:59 PN 68. -33761 5 Que at 11:5 1.5 pts 68a. Transcribe the mRNA molecule resulting from the following template DNA 33761 GTC-TAC-GCA-CTT-GGT-GCT-AGC-CTA-ACT-GAA-TCC 3761 - April Enter answer... -761 69. I 11 Second base of RNA codon +63 UUU UUC UGU _ Phenylalanine Phel VUA Serine Ser) UU LAC UAA UAG Tyrosine (Tyr) Stop Stop UUG Leul COU CAU UGC UGA Stop UGG Tryptophan (Top) CGU CGC Arginine CGA CGG Histidine CACH Proline...

  • The following genomic DNA sequence comes from the first exon of a human gene and contains...

    The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT