Question

Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? Wh

8) Draw the 6 steps of the bacterial translation cycle for the translation of an MK peptide. Show, and label, each of followi

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The tryptophan operon system codes for the essential aminoacid tryptophan. The tryptophan operon is present in many bacteria.The operon is regulated so that when tryptophan is present in the environment, the genes for tryptophan synthesis are not expressed.

Trp operon contains five structural genes: trpE, trpD, trpC, trpB, and trpA, It also contains a repressive regulator gene called trpR. trpR has a promoter where RNA polymerase binds and synthesizes mRNA for a regulatory protein. The protein that is synthesized by trpR then binds to the operator which then causes the transcription to be blocked. In the trp operon, tryptophan binds to the repressor protein effectively blocking gene transcription. In this situation, repression is that of RNA polymerase transcribing the genes in the operon.

Attenuator tp trpR trp trpP I r trpe . trob trp trpc trpc trpi troB trpa -23 trol;

Attenuation regulates the expression of trp operon in E.coli controlling the expression of tryptophan. The tryptophan operon is regulated by the repressor which when bounds to the operator blocks the synthesis of the amino acid. If the tryptophan is abundant the operon shuts down as the body of E.coli has enough amount of tryptophan but if there is scarcity of the tryptophan the operon system is in the ON state in the prokaryotic body and the mechanism of synthesis is turned on.

The mechanism of attenuation depends on the fact that translation in bacteria is coupled with transcription. Transcription termination depends on the hair pin loop structure that is formed by the complementary base pairing. This structure forms if the amino acid is present in enough amount the the process is to be halted.

Tuesday 2 Wednesday 3 Thursday 4 Friday 5 Saturday 6 Sunday 7 10 11 12 13 14 Week 43 2 Wednesday (295-083) X No 8.00 22 OctobTThis happens only in prokaryotes as the eukaryotes have each gene which is made of own individual RNA and each each gene has its own promoter.

Add a comment
Know the answer?
Add Answer to:
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alterna...

    Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....

  • Draw a diagrammatic interpretation of RNA polymerase pausing, antitermination, and attenuation that incorporates the mRNA, ribosome,...

    Draw a diagrammatic interpretation of RNA polymerase pausing, antitermination, and attenuation that incorporates the mRNA, ribosome, tryptophan, and trp-tRNA levels and how these lead to each step (i.e., pausing, antitermination, and attenuation) occurring in the leader region of the trp operon.

  • The piece of eukaryotic mRNA below includes the region that codes for the binding site for...

    The piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5GUU UCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? 88883 aឱ88 - GAC AAC UGC GNU ANU UGU GAG Ala Arg Asp Asn cys Glu Gin Gly is the low lys Met Phe Pro Ser The Trp...

  • STEP 1 HN-1 (8 pts) The figure at the right shows the stage in translation when...

    STEP 1 HN-1 (8 pts) The figure at the right shows the stage in translation when an incoming aminoacyl-tRNA has bound to the A-site on the ribosome (step 1). Using the same shapes for the tRNAs and amino acids shown in Figure A as a guide, show on Figures B and C what happens in the next two steps. Step 2 represents the peptidyl transferase reaction inherent to the large ribosomal subunit. In step 2 indicate the new peptide bond...

  • Questionz 1 pts Put the steps of polypeptide chain elongation and termination in order (after the...

    Questionz 1 pts Put the steps of polypeptide chain elongation and termination in order (after the initiation camnla bac formad [Choose ] Peptide bond formation between the polypeptide chain on the tRNA in the P site and the amino acid on the tRNA Translocation (the ribosome moves one codon toward the 3' end of the mRNA with the help of an elongation Step One ✓ The appropriate incoming aminoacyl-tRNA binds to an elongation factor bound to GTP The GTP is...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected...

    Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. promoter translation pause site RBS sigma factor tmRNA RNA polymerase stop codon transcription Rho factor ribosome start codon DNA polymerase attenuation tRNA The first step in gene expression is by to make an mRNA that encodes for one or more proteins. This requires...

  • 5) Translation was originally sorted out using a variety of inhibitors of protein synthesis Inhibitors tend...

    5) Translation was originally sorted out using a variety of inhibitors of protein synthesis Inhibitors tend to interrupt the process at a particular step and a population of translating ribosomes will all stop in the same state. An allied technique is to identify temperature sensitive mutations in various accessory factors. When the population of ribosomes is shifted to the restrictive temperature, ribosomes will stall when they need the function of the mutant protein to continue By analyzing the structure of...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • 29. Which of the following would be synthesized in and processed by the smooth endoplasmic reticulum...

    29. Which of the following would be synthesized in and processed by the smooth endoplasmic reticulum and Golgi apparatus? A. lipids and steroids B. DNA polymerase and RNA polymerase C. lysosomal enzymes D. cytoskeletal proteins 30. Which of the following are processed in the Golgi apparatus? A. integral membrane proteins of the plasma membrane B. proteins that are secreted from the cell C. proteins that will be broken down by lysosomes D. all of the above E. none of the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT