Question

11) A single base addition and a single base deletion approximately 15 bases apart in the...

11) A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its normal composition ...lys-ser-pro-ser-leu-asn-ala-ala-lys... to the abnormal form ...lys-val-his-his-leu-asn-ala-ala-lys...

a) Decipher the segment of mRNA for both the original protein and the double mutant.

b) Which base was added and which base was deleted?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

a-originl protein-...lys ..ser..pro..ser..leu..asn...ala..ala...lys..---lysine..serine..proline..serine..leucine..asparagine..alanine..alanine..lysine..                double mutant (abnormal condition)-lys..val-his-his-leu-asn-ala-ala-lys.---lysine-valine-histidine-histidine-leucine-asparagine-alanine-alanine-lysine..                          banswer----added base were-valine,histidine ,deleted base were-serine,proline.

Add a comment
Know the answer?
Add Answer to:
11) A single base addition and a single base deletion approximately 15 bases apart in the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 11) A single base addition and a single base deletion approximately 15 bases apart in the...

    11) A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its normal composition ...lys-ser-pro-ser-leu-asn-ala-ala-lys... to the abnormal form ...lys-val-his-his-leu-met-ala-ala-lys... a) Decipher the segment of mRNA for both the original protein and the double mutant. b) Which base was added and which base was deleted?

  • 2. A single nucleotide addition and a single nucleotide deletion approximately 15 base pairs apart in...

    2. A single nucleotide addition and a single nucleotide deletion approximately 15 base pairs apart in the DNA cause a protein change in sequence friom Old Phe-Ser-Pro-Arg-Leu-Asn-Ala-Val-Lys to ne Phe-Val-His-Ala-Leu-Met-Ala-Val-Lys a. What are the old and new mRNA nucleotide sequences? Old 5' uu Au b. Which nucleotide has been added? Which has been deleted?

  • A mutation causing an addition or a deletion of one base pair resulted in the production...

    A mutation causing an addition or a deletion of one base pair resulted in the production of a nonfunctional mutant protein. The sequences of the normal and mutant proteins are given below. Normal: Met - Leu - Ala - Thr - Gln Mutant: Met - Leu - Ala - His - Pro - Ile - Glu - Ser - Thr - Was this mutation cause by an insertion or a deletion? Answer Below, fill in the codons in the coding...

  • A single nucleotide deletion in the DNA causes a protein change in sequence from Ser –...

    A single nucleotide deletion in the DNA causes a protein change in sequence from Ser – Thr – Ile – Ser – Gly – Ala – Arg – Leu To Ser – Thr – Leu – Ala – Glu – Pro – Val What are the old and new mRNA nucleotide sequences?

  • An important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mutants induced by proflavin, a dye with a planar st...

    An important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mutants induced by proflavin, a dye with a planar structure that can intercalate (fit) between successive base pairs in DNA and induce frameshift mutations−that is, mutations involving additions or deletions of a single base. Streisinger and colleagues found that a particular single-base insertion mutation could be suppressed, with wild-type function restored, by a mutation that evidently involved a...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • Namer A) alternating sugar and nitrogen bases liked by peptide bonds B) complimentary bases held ...

    Namer A) alternating sugar and nitrogen bases liked by peptide bonds B) complimentary bases held together by hydrogen bonds 6) The backbone of a niacleic acid strand consists of: alternating sugar and phosphate groups linked by phosphate ester bonds D) alternating nitrogen bases and phosphate groups linked by amide bonds Q 7) 刁what amino acids are involved in the following tripeptide? NH-CH-C-NH-CH-- CH NH OH D) His-Lys-Phe A) Tyr-His-Lys C) Lys-His-Tyr B) Lys-His-Phe 8) Which list contains only neutral polar...

  • If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A....

    If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...

  • Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B....

    Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B. imaginarium (i.e. - after it is translated and released from the ribosome, a protease chews off a some amino acids).  The wild-type enzyme, which has had the amino acids removed from the C’-terminus, is 246 amino acids in length and the C-terminal amino acids are shown below aligned with the C-terminal amino acids of a frameshift mutant, which – due to a frameshift mutation -...

  • 21. One form of thalassemia has a single G->A mutation in the B-globin gene at the...

    21. One form of thalassemia has a single G->A mutation in the B-globin gene at the first nucleotide in the intron. This destroys the S' splice junction. The mRNA remains unspliced, leaving nucleotide intron in place. Assuming no stop codons are introduced in the intron pro second exon would be in-frame or out of frame in the translated protein dict if the A. In frame B. Out of frame Phe Ser Ty Cys U Phe Ser Cys Leu Se Stop...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT