Ans d. Protection from cytosolic enzymes .
The 3' poly A sequence is added once the elongation is complete ( end step of transcription).it helps to export the mRNA to the cytoplasm and also protects the mrNA from the cytoplasmic enzyme degradation. Also binds proteins which initiate the process of translation
C. Must be on the mRNA in order for the mature mRNA to be exported from the nucleus.
5 cap is a residue of 7 methyl guanosine which is linked to 5' terminal . This facilitates transport of mRNA to cytoplasm and also protects the mRNA from enzyme degradation .
D proline.
Codons are a sequence of three base pairs that represent an amino acid . The codonsf proline are CCC,CCA,CCG,CCT. Multiple codons can represent an amino acid.
A proline
Anticodon GGU is for proline . Anticodons are a sequence of three base pair which is complementary to codons present on tRNA. So the anticofons for proline are GGU, GGA,GGC,GGT.
If this helps please give it a positive rating. Thank you !
What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a....
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
A part of an mRNA molecule with the following sequence is being read by a ribosome: 5' CCG-ACG 3 (mRNA). The following charged transfer RNA molecules (with their anticodons shown in the 3' to 5' direction) are available. Two of them can correctly match the mRNA so that a dipeptide can form. Table 17.1 RNA Anticodon Amino Acid GGC Proline Alanine UGC Threonine Glycine Cysteine CGG Alanine CGU CCG ACG What is the anticodon loop of the first tRNA that...
Which process necessarily involves recognition of specific RNA sequences? Select one: a. Intron removal by mRNA splicing. b. Association of the ribosome 30s subunit with mRNA for the initiation of translation. c. Termination of translation. d. All of these e. None of these
The one-letter sequence is: WATER
a) Draw the peptide (R-groups trans), indicating charges, in
predominant form found at pH = 0.
b) What is the isoelectric point?
c) What is the average charge on the population of peptide
macromolecules at pH = 2.2?
d) What is the average charge on the population of peptide
macromolecules at pH = 12.5?
TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...
Compared to bacterial mRNA, eukaryotic mRNA needs an additional maturation processing by which ____ is removed such that the resulting mRNA contains only exons. This process is called RNA ___. Select one: a. capping ;;; reverse transcription b. intron ;;; reverse transcription c. transposon ;;; splicing d. intron ;;; splicing e. transposon ;;; recombination