The amino acid sequence for the given mRNA codon sequence is as follows-
5 terminus-met-ala-gly-ala-leu-stop-3terminus
Question 5 2 pts Given the following mRNA codon sequence, what will be the resulting amino...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Question 11 (1 point) Figure out the mutation. You will need the codon table for this question. WT genomic sequence of a portion of the ORF for a eukaryotic gene and matching amino acid sequence of that portion of its gene product. ATA GTG CGC TGT AGA CTC TAT GCG TCT GAG TCT ACG Ile Val Arg Cys Arg Leu Tyr Ala Ser Glu Ser Thr A mutant is found that has the following protein sequence: lle Val Arg Cys...