Use the codon sequence below to translate the following mRNA sequence (remember to start with the start codon - AUG - codes for methionine):
mRNA sequence - AUGUAUAAGUAA
[ Choose ] methionine lysine Stop tyrosine
1st codon
2nd codon
3rd codon
4th codon
2. Choose terms that are associated with eukaryotic transcription control.
Group of answer choices
operators
transciption factors
repressors
enhancers
Q. Use the codon sequence below to translate the following mRNA sequence (remember to start with the start codon - AUG - codes for methionine)
mRNA sequence – AUGUAUAAGUAA
Ans. mRNA sequence – AUG UAU AAG UAA
Protein sequence - Met - Tyr - Lys - Stop
1st codon [methionine]
2nd codon [tyrosine]
3rd codon [lysine]
4th codon [Stop]
Q. Choose terms that are associated with eukaryotic transcription control.
Ans. The terms associated with eukaryotic transcription control are “transciption factors”, “repressors” and “enhancers”.
Transcription factors are the protein molecules that regulates the rate of transcription in eukaryotes.
In eukaryotes repressors binds to the silencers and repress the transcription of gene associated with it.
In eukaryotes enhancers are the sequence that binds to activators and upregulate the rate of transcription of gene associated with it.
“Operators” is the terms associated with operon. Operon are the genes cluster and are associated with prokaryotic transcription.
Use the codon sequence below to translate the following mRNA sequence (remember to start with the...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume a stop codon is present and include it). Several correct sequences are possible due to the degeneracy of the genetic code; write only one sequence for each question. Remember to properly label ends. H2N - Methionine - Aspartate - Lysine - Serine - Valine - Leucine - COOH mRNA: DNA:
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
BONUS (10 points, 2 points each): Given below is a sequence of mRNA that is transcribed from a structural and mRNA: AUG CGC GOA UCC CCC ACC AGA ACG GAX UGA-3 G-C 1. Using the codon chart provided below, write down the predicted amino acid sequence of the protein the produced from this mRNA 3-UAC GCG EXU AGG GGG UGG UCU UGC COU 2). Write down the DNA sequence of the structural pene from which this mRNA sequence is transcribed...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
Using the following mRNA sequence, order the amino acids (which it codes for) in the correct sequence: mRNA: 5' - AUGUACCGAAUUGCCUAA -3' 3_Isoluceine 4 Alanine 1 Tyrosine 2 Stop 5 Methionine 6 Arginine Question 16 RNA polymerase Il promoters are located on theof each transcription unit. https://d21 rose.edu/d21/lmslquizzina/userattemptiquiz start framed2???:136082&isprv-8drc=0&qí 200802&cfq_0&dnb-0 5/6/2018 Quiz Submissions-CH 11 Hw Quiz-BIOL 2103 #2787 (Online) | Cell Biology. Rose State College 1) Outside 2) N-terminal 3) Inside 4) 3 side 5) 5'side
1. How is the start codon identified in prokaryotic cells? a. It is the only AUG on the mRNA strand. b. It is the AUG after the Shine-Dalgarno sequence. c. It is the AUG right next to the promoter on the mRNA. d. It is the AUG after the Kozak sequence. e. It is the AUG nearest the 5' end of the mRNA. 2. All of the following are true for eukaryotic transcription EXCEPT: a. Transcription can be terminated when...
The DNA sequence below is copied from question 30 and has a
mutation (highlighted in yellow).
TACGTACATACT
1) Transcribe the new sequence.
2) Translate the new sequence.
What is the mutation?
Original sequence:
TACGTCCATACT
Mutated sequence:
TACGTACATACT
(Glu) (Asp) Aspartic acid Glutamic acid Serine (Ser) Alanine (Ala) GU Jc Tyrosine (Tyr) A U Valine (Val) G А G Cysteine (Cys) с с U GTyptophan (Trp) START HERE Arginine (Arg) G U с A C Leucine (Leu) Serine (Ser) А с...
PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop. Follow example below: Example: DNA à AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC mRNA à UCU GCC AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG protein à start - glu – ala –thre – hist – asp –glu – threo - stop acid acid 5. DNA à CTA TTA CGA TAC...
3. What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct amino acid? 6. If each amino acid was encoded by a single codon, what is the minimum number of amino-acyl tRNA synthetases required for translation? 7. Looking at the codon table, if there was a unique aminoacyl-tRNA synthetase required for each anticodon, what is the minimum required? 9. If an aminoacyl-tRNA synthetase recognized any nucleotide (purine or pyrimidine) in the 5’end of the anticodon,...