List the sequence of events that must occur to initiate transcription, beginning with an mRNA molecule in the cytoplasm and ending with recruitment of the 2nd tRNA. Be specific about which ribosome sites are occupied.
I think, by mistake you wrote transcription in place of translation in question ....
I will be explaining intiation of translation:
1)firstly, Initiation factor 3 restrict binding of 30s subunit to 50s subunit.
2)mRNA binds to 30s subunit with shine Dalgarno 16sRNA sequence which is complementary to leader sequence present in mRNA.
3)intiation factor 2 with GTP helps in attachment of N-formylmethionyl-tRNA to 30s subunit at p-site.
4) 70s ribosome form by joining of 30s and 50s subunit with hydrolysis of GTP.
5)then intiation factor 1 help in removal of GDP and intiation factor2.
6) out of three sites of ribosomes - donor site, acceptor site and exit site, 2nd tRNA with aminoacid(aminoacyl-tRNA) enters acceptor site with help of aminoacyl-tRNA-GTP-elongation factor-Tu complex.
List the sequence of events that must occur to initiate transcription, beginning with an mRNA molecule...
there are multiple answers correct
MS Which of the following events occur during prokaryotic translation termination? The small ribosomal subunit binds with a specific tRNA to the mRNA and scans for a start codon. A tRNA recognizes the stop codon and the ribosome dissociates from the mRNA A protein recognizes the stop codon and the ribosome dissociates from the mRNA. A tRNA binds a codon and the ribosome adds amino acids from each tRNA to the polypeptide chain. Codons in...
Please explain
Why is a cap added to MRNA, but not to 1RNA or RRNA? Each of the three types of RNA are transcribed by different RNA polymerases. Only RNA polymerase II, involved in mRNA synthesis, contains a domain capable of interacting with enzymes that form the cap. Transcription and processing of MRNA occur in the nucleus, where cap binding proteins are found. These proteins, which add and modify the cap, are not found in the cytoplasm, where tRNA and...
1.A The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. This transcript arrives at a ribosome. Determine the anticodon sequence for the first three tRNA used to make the polypeptide. Label the 5’and 3’ends on the tRNAs. 5' AAUCGAUGUAAUCCGCAUC 3' B. Hydrolysis reactions They do so by link monomers to form a polymer; adding a water molecule remove monomers from...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
1 pts DI Question 6 What region of this molecule shown would bind to mRNA during translation? 3' A-OH 5' A Cacceptor stem G C G- U TuC loop D-loop C U GACAC m'A GGAGAGm m' G C-G A-U variable loop Anticodon loop Cm U A Gm A A The 5' end The anticodon loop The 3 end The variable loop The acceptor stem D Question 7 1 pts What is synthesized during transcription? O a strand of tRNA O...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
The next two questions are referring to the chart below: A part of an mRNA molecule with the following sequence is being read by a ribosome: 5' CCG-ACG 3' (MRNA). The following charged transfer RNA molecules (with their anticodons shown in the 3' to 5' direction) are available. Two of them can correctly match the mRNA so that a dipeptide can form. IRNA Anticodon GGC Amino Acid Proline CGU Alanine Threonine UGC CCG Glycine Cysteine Alanine ACG CGG X. 14...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
Answer the questions:
Question 1 Transcription begins at the..... a. operon o b. repressor c. genome 17d. promoter Question 2 0.5 points Save RNA is synthesized on a DNA template in a process called replication, DNA polymerase translation, RNA polymerase transcription, RNA polymerise t ranscription, DNA polymerase Question 3 Which eukaryotic RNA polymerase makes tRNA's? a RNA polymerase IIIb. Any of these RNA polymerase I od RNA polymerase II A Moving to another question will save this response. Question 4...
Receptor-mediated endocytosis depends on functional cell surface receptor proteins True O False Question 29 1.5 pts A certain cell needs to move a molecule of sucrose out of the cell. The concentration of sucrose in the extracellular space is greater than that in the cell's cytoplasm. What type of transport mechanism would the cell use? O passive transport exocytosis active transport osmosis In the lipid bilayer the phospholipid tails are hydrophobic hydrophilic Question 31 1.5 p A human white blood...