Question

Part A What is the process of synthesizing protelins from MRNA sequences? translation replication transcription transformatio

0 0
Add a comment Improve this question Transcribed image text
Answer #1

To answer the question, first of all, we have to understand the processes mentioned above.

1) Translation- Translation is a cellular process in which polypeptide chains or proteins are synthesized by the activity of mRNA and ribosomes. This process is also known as gene expression.

2) Replication- Replication is a process in which synthesis of new DNA occurs from pre existing DNA molecules in a semi conservative manner.

3) Transcription- Transcription is a process where single stranded RNA molecule is synthesized from double stranded DNA molecule. One DNA strand serves as template strand and the other as coding strand.

4) Transformation- Here, bacterial cells uptake exogenous genetic material from its surrounding environment. The exogenous genetic material gets incorporated into the bacterial genome.

5) Transduction- In this process viruses act as vectors by which exogenous genetic material gets incorporated into bacterial cells as they are attacked by the viruses.

Based on the above explanations, the correct option will be TRANSLATION

Add a comment
Know the answer?
Add Answer to:
Part A What is the process of synthesizing protelins from MRNA sequences? translation replication transcription transformation...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...

    The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...

  • 1. What is the significance of transcription and translation in overall physiology of Human or bacterial...

    1. What is the significance of transcription and translation in overall physiology of Human or bacterial cells? 2. What is transcription? 3. What is translation? 4. What are the differences between Transcription and replication 5. What're the differences between the Transcription and Translation process in human cells versus bacterial cells? 6. What are the functions of RNA polymeraseI, Il and 1lI? 7. What is a promoter and what are the important sequences within a promoter? 8. What is the role...

  • 1. The figure above represents A. replication B. transformation C. transcription D. translation

    1. The figure above represents A. replication B. transformation C. transcription D. translation

  • What is main difference between Prokaryotic and Eukaryotic DNA replication and transcription/ translation processes? what are...

    What is main difference between Prokaryotic and Eukaryotic DNA replication and transcription/ translation processes? what are the three ways mRNA gets processed prior to leaving the Nucleus? What is alternative splicing?

  • 4. When & where does replication occur? 5. What is the point of transcription? Where does it occur? 6. What are...

    4. When & where does replication occur? 5. What is the point of transcription? Where does it occur? 6. What are three nucleotides together called on mRNA? (ie: ACA) 7. The mRNA codons can be used in a chart to find: 8. What molecule contains an anti-codon? During what process is it used? 10. Translation takes place in a 11. and _make up ribosomes. 12. What is the point of translation? 13. Transcription and translation together is the process of

  • BI U A. A. EEE 1. What is replication? 2. What is Transcription? 3. What are...

    BI U A. A. EEE 1. What is replication? 2. What is Transcription? 3. What are the differences between replication and transcription? 4. What is translation? 5. What is the role of mRNA, TRNA, and tRNA during translation? 6. What is the function of ribosomes? 7. Which enzyme catalyzes the transcription? 8. A DNA molecule has two strands (double helix) - how many of its strands are/is replication and transcription? 9. What is the difference between transcription and translation occurring...

  • Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...

    Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...

  • DNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication

    Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...

  • In bacteria, the process of translation affects the speed of transcription—efficient binding and progression of ribosomes...

    In bacteria, the process of translation affects the speed of transcription—efficient binding and progression of ribosomes along the mRNA increases the speed of transcription, whereas the absence of ribosomes on the mRNA slows the movement of RNA polymerase along the DNA. Treatment of bacteria with an antibiotic that inhibits translation slows the progression of RNA polymerase along the DNA. Likewise, if ribosomal proteins are mutated in a way that slows or inhibits translation, the process of transcription also slows. Furthermore,...

  • Indicate which cellular processes directly require DNA replication (R), transcription (TC), or translation (TL). 'Directly' means...

    Indicate which cellular processes directly require DNA replication (R), transcription (TC), or translation (TL). 'Directly' means the cellular process that must occur immediately before the one in the question. synthesis and secretion of insulin from the liver meiosis of spermatogonia production of LH mRNA in the pituitary gland mitosis of intestinal epithelial cells synthesis of steroid hormone receptors

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT