Question

The schematic illustrates steps in RNA processing. The DNA strand is shown in red and yellow, and the RNA strand is shown in green and blue. The steps in RNA processing are labeled 1-3, and the components of the RNA transcript are labeled A-C.
Image for The schematic illustrates steps in RNA processing. The DNA strand is shown in red and yellow, and the RNA stra

Steps in RNA processing are indicated below in alphabetical order, select the step number to put these processes in chronological order. If the indicated step does not occur, select 'This process does not happen'.

removal of exons

Answer: step 3This process does not happen.step 1step 2

removal in introns

Answer: step 1step 3step 2This process does not happen.

transcription of DNA into mRNA

Answer: step 2step 1step 3This process does not happen.

transcription of mRNA into DNA

Answer: step 1step 3This process does not happen.step 2

translation of DNA into mRNA

Answer: step 1step 2step 3This process does not happen.

capping of mRNA

Answer: step 2step 1step 3This process does not happen.

Indicate the correct match to identify the components of the final product from these processes.

component A

Answer: 3' cap, 3' polyA tail, final coding region, 5' cap, or 5' polyA tail

component B

Answer: 3' cap, 3' polyA tail, final coding region, 5' cap, or 5' polyA tail

component C

Answer: 3' cap, 3' polyA tail, final coding region, 5' cap, or 5' polyA tail
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Removal of exons-this step does not occur

Removal in introns-step 2

Transcription of DNA into mRNA-step1

Transcription of mRNA into DNA-This step does not occur

Translation of DNA into mRNA-This step does not occur

Capping of mRNA-step 3

Component A-5’ cap

Component B- final coding region

Component C- 3’poly A tail

Add a comment
Know the answer?
Add Answer to:
The schematic illustrates steps in RNA processing. The DNA strand is shown in red and yellow,...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Eukaryotic messenger RNA undergoes several processing steps after transcription before it binds to ribosomes as the...

    Eukaryotic messenger RNA undergoes several processing steps after transcription before it binds to ribosomes as the template for protein synthesis. One of these steps is polyadenylation. Identify whether the statements below about polyadenylation are true or false. A polymerase adds a polyadenylate tail of about 10 nucleotides to the 3' end of the mRNA. A polymerase adds a polyadenylate tail to the mRNA while it is still in the nucleus. The polymerase forming the polyadenylate tail uses a polydT DNA...

  • Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript...

    Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...

  • 2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...

    2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...

  • 1 pts DI Question 6 What region of this molecule shown would bind to mRNA during...

    1 pts DI Question 6 What region of this molecule shown would bind to mRNA during translation? 3' A-OH 5' A Cacceptor stem G C G- U TuC loop D-loop C U GACAC m'A GGAGAGm m' G C-G A-U variable loop Anticodon loop Cm U A Gm A A The 5' end The anticodon loop The 3 end The variable loop The acceptor stem D Question 7 1 pts What is synthesized during transcription? O a strand of tRNA O...

  • can you make an outline/ give each step of transcription/ rna processing from: DNA to pre-mRNA...

    can you make an outline/ give each step of transcription/ rna processing from: DNA to pre-mRNA processing initiation elongation termination transcription regulation transduction pathways, transcription factors, protein bridges termination/processing adding 3' poly A tail intron splicing alternative splicing lariat structure coupling transcription self splicing introns

  • A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication...

    A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication fork, DNA polymerase III, primase, and ligation. Make sure that your answer is complete and that all the entities that come together in the process of lagging strand replication are clearly explained. Draw one figure of a replication fork with the polarity (directionality) of each DNA strand indicated. G) Explain RNA transcription in E. coli in detail, from initiation to termination. Underline the following...

  • Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in...

    Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in the lungs and it carries it to tissues and cells throughout the body. Hemoglobin is made of four polypeptide chains, two called “alpha-globins” (a) and two “beta-globins" (B). The B-globin polypeptide is produced in the cells based on the sequence of the HBB gene. The structure of the HBB gene that codes for beta-globin is represented below. The primary transcript is 1606 nucleotides long....

  • a piece of eukaryotic DNA is shown below:                      5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA...

    a piece of eukaryotic DNA is shown below:                      5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA PRODCUED, IF THIS IS THE CODING STRAND? b)Assuming that after processing, a cap is added to the mRNA at the 5’ end, predict the amino-acid sequence of the protein produced from this piece of mRNA using SINGLE LETTER codes. In your answer denote both the amino and carboxy ends of the protein? THANKS FOR THE HELP.

  • allll pleas Question 14 (1 point) Eukaryotes modify a primary RNA transcript to generate a final...

    allll pleas Question 14 (1 point) Eukaryotes modify a primary RNA transcript to generate a final mRNA product. Which of the following modifications is something that occurs to eukaryotic RNA (which one is correct): OA) removing exons from the transcript B) adding introns into the transcript C) adding a poly(A) tail to the transcript by poly(A) polymerase OD) adding start codons to the transcript after its synthesis E) removing a 5' cap from the transcript Question 18 (1 point) Origins,...

  • help me answer these- One strand of a section of DNA Isolated from the bacterium E....

    help me answer these- One strand of a section of DNA Isolated from the bacterium E. cow reads: answer all parts 5- GTAAGCTACGGATAGG -3 A. Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template meaning this is the coding strand). What will be the sequence of the mRNA in this region (make sure you label the 5 and 3' ends of the mRNA)? B. How many different peptides could potentially be made from...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT