Question

Below is a small segment from a file containing a DNA sequence: Information Flag question AGATAGA Consider the problem of cou

What are ALL the key, value pairs input to the Reduce steps: Select one: o a. (AGA, [1,1,1]), (GAT,[1,1,1]), (ATA,[1,1,1]), (

0 0
Add a comment Improve this question Transcribed image text
Answer #1

3. d

  • The map function will count all the break the DNA sequence into 3 length sequence and count as 1.
  • AGATAGA, it will start from the first letter and will run for the three letters and hence, (AGA,1).
  • Then, (GAT,1), (ATA, 1), (TAG,1), (AGA,1) and these are the only 3 length sequence.

4. c

  • After the map function, there is a shuffle function that will shuffle all the keys together and then pass the values to the reduction.
  • Shuffle will take the keys and append all the values received from Map function.
  • Hence, (AGA,[1,1]) as there are 2 outputs for AGA.
  • (GAT,[1]), (ATA,[1]), (TAG,[1]).

5. d

  • Reduce function will add all the values that are passed to it keeping the key constant.
  • So (AGA,2) and rest all keys have only 1 value. So, it will produce (GAT,1), (ATA,1), (TAG,1).

Friend, this was a really nice question to answer. If you find my answer helpful, please like it. Thanks.

Add a comment
Know the answer?
Add Answer to:
Below is a small segment from a file containing a DNA sequence: Information Flag question AGATAGA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence fil...

    Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence file (alternatively you can use the getRandomSeq(long) method of the RandomSeq class to generate a piece of DNA sequence), and then print out all the codons in three forward reading frames. Design a method called codon() that can be used to find all the codons from three reading frames. The method will take in an argument, the reading frame (1, 2, or...

  • Question 11 Not yet answered Marked out of 1.00 P Flag question The DNA of an...

    Question 11 Not yet answered Marked out of 1.00 P Flag question The DNA of an organism is studied and found to contain 14% guanine. This organism should have __% thymine and __% cytosine in its DNA. Select one: O a. 36; 36 O b. 14; 36 O c. 14; 86 O d. 36; 14 Question 12 Not yet answered Marked out of 1.00 Flag question The strands of a DNA double helix are said to be antiparallel. This means...

  • Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA...

    Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA molecules used in the manufacture of proteins is also known as a(n) intron. mutation. gene. codon. Flag this Question Question 3 1 pts A small segment of DNA on the template strand contains the base sequence CGT. If an mRNA transcript is made that includes this sequence, what would be the anticodon on the tRNA that would bind to this corresponding mRNA sequence? CGT...

  • Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA...

    Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c....

  • Information P Flag question Consider a firm operating two plants. It can produce Good X and...

    Information P Flag question Consider a firm operating two plants. It can produce Good X and Y in either plant, and the PPF of each plant is listed below. • Plant 1: Y1 = 100 -0.01x? • Plant 2: y2 = 400 - 0.1X2 The firm currently produces only Good X in Plant 1 and only Good Y in Plant 2. Follow the steps below to find out if the current output bundle is on the PPF of the firm....

  • Question 6 Not yet answered Marked out of 5.00 P Flag question Find the intervals on...

    Question 6 Not yet answered Marked out of 5.00 P Flag question Find the intervals on which f(x) = 2x3 – 6x – 3 is increasing and decreasing. Select one: O a. Increasing on (-0, -1)) and on (1, 0); Decreasing on (-1,1) O b. Increasing on (-1,1); Decreasing on (-00,-1) and on (1, 0) C. Increasing on (-0,1); Decreasing on (1, 0) O d. Increasing on (1, 0); Decreasing on (-0,1) e. Increasing on (-0, 7))) and on (1,...

  • Information Quit P Flag question i Answer Questions based on the following graph. The graph below...

    Information Quit P Flag question i Answer Questions based on the following graph. The graph below illustrates a simple exchange economy with two consumers, A and B, with Good X on the horizontal axis and Good Y the vertical. The economy is producing at Point E on the PPF. Point Fillustrates how the output of the economy is allocated to the two consumers, A and B. (Note that the origin point for Consumer A in the Edgeworth exchange box, Point...

  • Information Flag question Determine the magnitude and direction of all support reactions for the pin-jointed structure...

    Information Flag question Determine the magnitude and direction of all support reactions for the pin-jointed structure shown below. 450 lb/ht 7 ܠܠܠܠܓ 31 81 + 1 D Question 1 Points out of 1.00 P Flag question Not yet answered Ax= Select one: O a. 7200 lbs. - O b. 5400 lbs. - O c. 7200 lbs. - O d. 5400 lbs.- Question 2. Points out of 1.00 P Flag question Not yet answered Ay= Select one: O a. 1350 lbs....

  • The figure below shows a restriction map of a segment of a DNA molecule. Eco refers...

    The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...

  • Question 26 Refer to the image below. Which of the plate quadrants is the most useful...

    Question 26 Refer to the image below. Which of the plate quadrants is the most useful for isolation of a single colony? Not yet answered Points out of 1.00 P Flag question 1 2 4 3 Select one: a 1 b. 2 Oc.3 O d. 4 Question 27 Which of the following is an end product of fermentation? Not yet answered Points out of 1.00 Select one: a glucose O b. carbon dioxide P Flag question C. oxygen d. fat...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT