Question

d. She finds a mutation in which blood sugar levels stay abnormally high after meals. To identify the location of this mutation she decides to sequence the genome of homozygous mutant embryos. She compares this sequence to a sequence from a homozygous wildtype sibling. These sequences are below. Wt AGAGGATGATCCTAAACAAAGCTCTGATCCTG Mut AGAGGATGATACTAAACAAGCTCTGATCCTGG i. What kind of mutations did she find in her sequence? Label them and indicate the type of mutation. (15 pts) ii. How are these mutations likely to affect the protein function? Are any of these likely to cause the amorph shes looking for? Why? (15 pts)
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Mutation:

Mutation is the permanent change in the sequence of a gene in an organism. Mutation might be lethal, disease causing, or some time have no effect.

Mutation is caused due to DNA replication errors or DNA damage. DNA damage is caused by exposure to radiation or exposure to carcinogens.

Types of mutation:

Substitution mutation:

Substitution mutation can be transition or transversion. Transition is when purine is replaced with purine or pyrimidine with pyrimidine that is A to G, or G to A, or C to T, or T to C.

Transversion is when purine is replaced with pyrimidine. That is C/T to A/G.

Point mutation:

When a gene has a single base pair change it is called as the point mutation.

Silent mutation:

Silent mutation is one in which change in the DNA sequence does not affect the amino acid it codes for.

Missense mutation:

Change in DNA sequence codes for a different amino acid.

Non sense mutation:

When mutation results in stop codon.

Insertion:

When one or more nucleotides are added to the DNA sequence.

Deletion:

When one or more nucleotides are deleted in the DNA sequence.

Answer:

  1. What kind of mutations did she find in her sequence? Label them and indicate the type of mutation.

The given sequence has 3 types of mutation.

  • At position 11 it has a substitution mutation – transversion where C is replaced with A.
  • At position 20 it has a deletion of a single nucleotide where A is missing in the mutant DNA sequence.
  • At position 33 it has a insertion of a single nucleotide where G is inserted in the mutant DNA sequence.

2. How are these mutations likely to affect the protein function? Are any of these likely to cause the amorph she’s looking for? Why?

  • These mutations results in change in the protein sequence.
  • When protein sequence composition is altered, the structure of the protein is altered.
  • The mutant protein has different structure and its function is affected.
  • The loss of function of the mutant protein will result in disease.

wild type: AGA GGA TGA TCC TAA ACA AAG CTC TGA TCC TG Amino acid it codes for Arg Gly stop ser stop Thr Lys Leu stop ser MutaThe substitution mutation in the mutant sequence resulted in the change in the amino acid it codes for from Serine to tyrosine.

The deletion of a nucleotide has resulted in the change in the reading frame which change the amino acid it codes for completely after the deleted nucleotide position.

Thus this mutation results in the change in the protein composition which affects the structure and function of the protein.

Add a comment
Know the answer?
Add Answer to:
d. She finds a mutation in which blood sugar levels stay abnormally high after meals. To...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...

    2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT