show me the mechanism of cleavageof pro-pro-leu using edmon degradation

Question

Question

science chemistry

Answer 1

Answer #1

-> 1 NH NH -Ph Ph-N C=S Pro-Pro-Leu) NH. H-N Pro-Leu Thus cleavage of peptide Occurs degradha tHon rengent (Ph-NCs)

Answer 2

Similar Homework Help Questions

16.From the following data on progeny of the cross Hfr++++X F his leu met pro The numbers indicat...

please explain your answer this was all the information given to me 16.From the following data on progeny of the cross Hfr++++X F his leu met pro The numbers indicate the number of colonies detected on a plate made with the medium supplements in the column Minimal Medium supplements (all contain streptomycin) Time(min) leu eu IS met eu IS met IS met ro 20 30 40 100 500 500 100 1000 1000 1000 100 500 200 The order of entry...
Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-I

Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-Ile-Asn-ser-Ile-Asn-Phe-Asp-Asn-Pro-Val-Tyr-Gln A. 773 B. 792 C. 811
Draw the structure of the phenylthiohydantoin product you would obtain by Edman degradation of these peptides....

Draw the structure of the phenylthiohydantoin product you would obtain by Edman degradation of these peptides. Show the configuration of the chirality center on the heterocycle. a) H-Ile-Leu-Pro-Phe-OH b) H-Asn-Thr-Ser-Gly-Ala-OH Please answer both A and B

Melanocyte-inhibiting factor is a tripeptide derivative, also known as Pro-Leu-Gly-NH2. It has antidepressant and anti-Parkinsonian effects....

Melanocyte-inhibiting factor is a tripeptide derivative, also known as Pro-Leu-Gly-NH2. It has antidepressant and anti-Parkinsonian effects. Design the synthesis of this compound from amino acids Pro, Leu, and Gly. (Hint: protection and deprotection are needed for the precise synthesis). 2. Melanocyte-inhibiting factor is a tripeptide derivative, also known as Pro-Leu-Gly- NH2. It has antidepressant and anti-Parkinsonian effects. Design the synthesis of this compound from amino acids Pro, Leu, and Gly. (Hint: protection and deprotection are needed for the precise synthesis).
[B] Draw structure of the pentapeptide Met-Phe-Leu-Pro -Trp (10 Points)

[B] Draw structure of the pentapeptide Met-Phe-Leu-Pro -Trp (10 Points)
Write down the mRNA sequence for: start-val-ala-thr-thr-leu-tyr-cys-gly-arg-stop start-lys-asn-gly-phe-his-thr-arg-pro-gln-stop start-met-thr-asn-lys-pro-gln-ser-leu-arg-stop

Write down the mRNA sequence for: start-val-ala-thr-thr-leu-tyr-cys-gly-arg-stop start-lys-asn-gly-phe-his-thr-arg-pro-gln-stop start-met-thr-asn-lys-pro-gln-ser-leu-arg-stop

can you guys help me show the reaction mechanism? using curved arrows to indicate electron flow....

can you guys help me show the reaction mechanism? using curved arrows to indicate electron flow. thank you ! ) Show the reaction mechanism clearly for the following conversion. Use curved rrows to indicate the direction of electron flow. HOOH/ heat + HBr Br
what is a possible mechanism for the disruption of protein degradation pathways? please be detailed.

what is a possible mechanism for the disruption of protein degradation pathways? please be detailed.
(A) What are the correct DNA sequences that led to the following polypeptide sequences? (i) Met-His-Pro-Leu-Cys-Tyr-Stop...

(A) What are the correct DNA sequences that led to the following polypeptide sequences? (i) Met-His-Pro-Leu-Cys-Tyr-Stop (ii) Met-Ser-Leu-Asp-Ala-Trp-Stop (B) What are the correct polypeptide sequences that result from following DNA sequences? (i) tgaggcataacttactgacttgcccttacgactaagattcttt (ii) ggtaagtcctctagtacaaacacccccaatattgtgatata

Please show full mechanism with arrows and mechanism name for this multi synthesis problem(C-G) Me Me...

Please show full mechanism with arrows and mechanism name for this multi synthesis problem(C-G) Me Me HX Me Et Me Et OH s-CI Me EtgN BuOK C 1) ВНн, 2) NaOH H2O2 MeOK Br2 F Me Et G O SIO