Question

QUESTION 33 What amino acid sequence would be found in the polypeptide produced from this mRNA? Follow the normal rules for g
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The given mRNA sequence is...

5' - A G C A A U A U G G C G A U U C G C U G A G U A C C U - 3'

According to the normal rules of gene expression, the the transcription will begin from the start codon and will end in the stop codon. Means, the first amino acid incorporated to the polypeptide chain will be carried by the tRNA which has the anticodon to the start codon. And there's no tRNA with the complementary anticodon to stop codon. So, there the elongation of polypeptide chain will stop and the translation will ultimately terminate. AUG, GUG, UUG are the start codons, among which the AUG is most abundant which codes for methionine in eukaryotes and formylated methionine in prokaryotes. UAA, UAG and UGA are the stop codons.

Following the above rules of gene expression, the translated polypeptide chain from the above alluded mRNA will have the sequence as following...

Met (strat) - Ala - Ile - Arg - (stop)

**** IF YOU LIKE THE ANSWER PLEASE HIT THE THUMBS-UP. THANK YOU :-)

Add a comment
Know the answer?
Add Answer to:
QUESTION 33 What amino acid sequence would be found in the polypeptide produced from this mRNA?...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...

    Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...

  • 1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino...

    1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino acid sequence of the protein that will be found in each of the following mutations. Please also list an anticipated phenotypical change(s) (nonsense, missense, frameshift, addition/subtraction of amino acid etc.) (1 pts each) Second position Nucleotide #: 1 4 7 10 13 U UUU 16 19 22 UCU UAU UGU UUC UAC UAA UUA UUD RNA: 5-AUG ACC GGC AAU CAA CUA UAU UGA-3'...

  • Consider the amino acid sequence Identify the MRNA codon sequences that would be translated into this...

    Consider the amino acid sequence Identify the MRNA codon sequences that would be translated into this amino acid sequence. Serine-Alanine-Proline-Aspartic acid Use the codon table to answer the question. UCA-GCG-CCC-GAU UCU-GCU-CCU-GAC CCA-GCA-UCC-GAC UCA-GUA-CCA-AAU UCC-GCA-CCA-GAC

  • Amino Acid Sequence Codoms Snicker's mRNA S-AUG GUA UCU AAA (GUU CCU ACU GAA AAGCUU CUC...

    Amino Acid Sequence Codoms Snicker's mRNA S-AUG GUA UCU AAA (GUU CCU ACU GAA AAGCUU CUC CUC CCCI GUU GCG GCU CAUCACIGUA UUU UAUIGUA AU CUU CUG CCC ACA GUU GAC GAC GCAUUC UCG GGU LAGA UAU UGUJUAA Antisense Strand DNA: Sense Strand DNA 53 Amino Acid Sequence Genel body covering Gene 2 - body style Gene 3 - legs Gene 4 - head shape Gene Stails Gene 6 - body pigment Gene 7 - eyes Gene 8 - mouth...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the...

    The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...

  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure...

    The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...

  • If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

    If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT