Question

How would you proceed?

interpret the image of gel electrophoresis and discuss what you might do in subsequent pcr experiment with this primer?

COURSE 2.jpg

0 0
Add a comment Improve this question Transcribed image text
Request Professional Answer

Request Answer!

We need at least 10 more requests to produce the answer.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)


All students who have requested the answer will be notified once they are available.
Know the answer?
Add Answer to:
How would you proceed?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • • What would you expect to see on a gel if PCR is performed for a...

    • What would you expect to see on a gel if PCR is performed for a microsatellite in a person with a genotype indicated by: • (Allele 1: 3 TAGA repeats) • (Allele 2: 6 TAGA repeats) -----------TAGATAGATAGA----------- -----------TAGATAGATAGA TAGATAGATAGA--- A. 9 bands on the gel (or capillary electrophoresis) B. 6 bands on the gel (or capillary electrophoresis) C. 3 bands on the gel (or capillary electrophoresis) D. 2 bands on the gel (or capillary electrophoresis) E. 1 band on...

  • What would you expect to see on a gel if PCR is performed for a microsatellite...

    What would you expect to see on a gel if PCR is performed for a microsatellite in a person with a genotype indicated by: (Allele 1: 3 TAGA repeats) (Allele 2: 6 TAGA repeats) ---TAGATAGATAGA------ ---TAGATAGATAGA TAGATAGATAGA-- A. 9 bands on the gel (or capillary electrophoresis) B. 6 bands on the gel (or capillary electrophoresis) C. 3 bands on the gel (or capillary electrophoresis) D. 2 bands on the gel (or capillary electrophoresis) E. 1 band on the gel (or...

  • 1. Using your understanding of PCR amplification answer the following questions: a) How do you know...

    1. Using your understanding of PCR amplification answer the following questions: a) How do you know if a primer dimer is created during PCR? b) What is nonspecific PCR amplification and how do you know if it exists during PCR? c) What are the possible results you could expect to observe on the agarose gel from your PV92C results? Use a schematic diagram and draw a gel to illustrate where the PV92 primers bind. You should also consider where the...

  • You are provided with two primers below and you wish to amplify the CYC1 terminatoron pMD1:...

    You are provided with two primers below and you wish to amplify the CYC1 terminatoron pMD1: Primer 1: CTATGAAACAAGAATCGACC Primer 2: GTGCCGTAAAGCACTAAATC a. What secondary structure is formed by each primer at 54°C? b. What secondary structure is formed by both primers together at 54°C? c. If we were to use the following PCR protocol with primer 1 and primer 2, what would we expect to see on the electrophoresis gel? Step Time Temperature Initiation 2’ 95°C Denaturation 1’ 95°C...

  • Questions? BIOTECHNOLOGY: Describe and explain what restriction enzymes are? what their important characteristic are, and how...

    Questions? BIOTECHNOLOGY: Describe and explain what restriction enzymes are? what their important characteristic are, and how they work, and how they can be used for forensic applications( RFLP analysis) Explain and understand gel electrophoresis, how does IT sort Dna by size? You should understand what PCR is and the basic of how IT works and its forensic applications (STR analysis) of present with a gel fragment pattern, you should be able to interpret it.

  • CALCULATIONS [2 points each] You are asked to perform a PCR experiment in the lab. However, in th...

    CALCULATIONS [2 points each] You are asked to perform a PCR experiment in the lab. However, in this experiment you must add each ingredient separately (unlike the "master-mix" we used in our own experiment). In this experiment, each PCR reaction tube contained the following ingredients added with a micropipetor... 10 HL of 5x Buffer 6 μ1 of 25 mM MgCl2 solution μL of 10 mM dNTP mix 1.5 μL oligonucleotide primer mix 0.5 HL Taq DNA Polymerase stock solution 28...

  • 1.) How many kinds of reverse transcriptases are there ? 2.) What would normally be a...

    1.) How many kinds of reverse transcriptases are there ? 2.) What would normally be a proper order to assemble yout RT reaction mix ? Your PCR mix ? Why is the order important ? 3.) Why do you need many PCR cycles to see reaction products ? 4.) Why are multiple product bands sometimes seen during PCR reactions ? How can this problem be minimized ? 5.) Betaine is often included in transcription reactions. What is betaine ? What...

  • Explain at least one possible reason why you might have the following results in an agarose...

    Explain at least one possible reason why you might have the following results in an agarose gel electrophoresis of your PCR products. In addition to your DNA PCR sample, you also ran a Hi-Lo Marker, a positive PCR control, and a negative PCR control. 16. Scenario C: Your Hi-Lo marker showed up but there were no bands in the lanes for your PCR positive control, DNA PCR sample or negative PCR control.

  • En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard...

    En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....

  • Day 1, You have isolated DNA from 30 individuals and performed restriction enzyme digestion. You have...

    Day 1, You have isolated DNA from 30 individuals and performed restriction enzyme digestion. You have loaded the product and run the gel electrophoresis following the instruction properly. You expected to see DNA bands after the procedure is completed, like figure A, but after the completion of the run your gel looks like figure B. You did not see any DNA band. You were so upset, but your lab partner fixed the problem and your gel looked like figure A....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT