You are provided with two primers below and you wish to amplify the CYC1 terminatoron pMD1:
Primer 1: CTATGAAACAAGAATCGACC
Primer 2: GTGCCGTAAAGCACTAAATC
a. What secondary structure is formed by each primer at 54°C?
b. What secondary structure is formed by both primers together at 54°C?
c. If we were to use the following PCR protocol with primer 1 and primer 2, what would we expect to see on the electrophoresis gel?
|
Step |
Time |
Temperature |
|
Initiation |
2’ |
95°C |
|
Denaturation |
1’ |
95°C |
|
Annealing |
1’ |
53°C |
|
Extension |
1” |
72°C |
|
Final extension |
10’ |
72°C |
|
End |
4°C |
∞ |
d. Suggest an optimized PCR protocol based on the one from question 24 and using primers 1 and primer 2. Explain also how it would improve somewhat the amplification of the CYC1 terminator.
|
Step |
Time |
Temperature |
|
Initiation |
||
|
Denaturation |
||
|
Annealing |
||
|
Extension |
||
|
Final extension |
||
|
End |
A) primer 1 separately may form self dimer and primer 2 forms hairpin in 54°c
B) heterodimer may be formed with both primer together
C) due to secondary structures , there will be less amplification in PCR
D)
| Step | time | temperature |
| Initiation | 2 | 95 |
| Denaturation | 1 | 95 |
| Annealing | 1 | 54 |
| Extension | 1 | 72 |
| Final extension | 10 | 73 |
| End | 4° | Infinity |
By increasing the annealing temperature , we can reduce misamplification and increase the specificity to the particular gene CYC1 terminator
You are provided with two primers below and you wish to amplify the CYC1 terminatoron pMD1:...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
need help with this
Tm: Tm: 16. You wish to amplify the DNA fragments below and add cut sites for subsequent cloning. Design both primers with the restriction enzymes cut sites listed, and add two overhang bases to each primer. Label the extra bases and cut sites. Each primer should be 14 nucleotides in length. a. 5'-CTATGAGGTCCTGCGTTAGTGTTACC-3' Forward: 5'- 5' EcoRI, 3' BamHI, overhang bases Reverse: 5'- Annealing Temperature: b. 5'- CCTGGGTGTTACATGCCATTAGCGTT-3' Forward: 5'- Tm: 5' HindiII, 3' Sphl, overhang...
1. What are the degenerate primers in the PCR amplification protocol? What do they do? 2. Suppose you begin a PCR reaction with 1 piece of double stranded DNA. After 30 cycles of replication, how many pieces of double stranded DNA do you now have? 3. What would be the consequence of having too much DNA in the sample? Would it interfere with the PCR reaction? Why? 4. What happens during the annealing step of the PCR reaction? During the...
1. Create the primers to amplify the gene of interest. 1. Below is almost the full sequence of the coding strand of the F9 gene (exon 2-exon4) that you found in the online database (NCBI, Genomic sequence F9 gene). Some of the sequence is missing, but you know how many nucleotides are skipped. Design forward and reverse primers 18nt each for PCR that will isolate EXACTLY the sequence that is in bold typeface. Exon 2 = 164 nt Intron 2...
You want to use PCR to amplify the entire DNA shown in the figure below. Of the listed primers, choose the pair that will allow you to amplify this stretch of DNA by PCR. (9 points total) DNA to be amplified 5’-CGATTCGAGCCATTCGAACTCGATCAGCCGATTCGATCAACCTTGGACAGTCAG-3’ 3’-GCTAAGCTCGGTAAGCTTGAGCTAGTCGGCTAAGCTAGTTGGAACCTGTCAGTC-5’ Primers: (1) 5’-GCTAAGCTCGGTA-3’ (5) 5’-CTTGGACAGTCAG-3’ (2) 5’-GAACCTGTCAGTC-3’ (6) 5’-CGATTCGAGCCAT-3’ (3) 5’-CTGACTGTCCAAG-3’ (7) 5’-ATGGCTCGAATCG-3’ (4) 5’-GACTGACAGGTTC-3’ (8) 5’-TACCGAGCTTAGC-3’ Answer: I will need primer number _____ and primer number _____
RNA differs from DNA in that it: all of the above contains ribose sugar contains uracil is usually found as a single-stranded molecule in cells Question 21 pts The correct order of steps in a PCR cycle is: Extension, denaturation, annealing Annealing, extension, denaturation Annealing, denaturation, extension Denaturation, annealing, extension The goal of the polymerase chain reaction (PCR) is to: Amplify a small amount of DNA sequence Cleave DNA molecules Digest bacterial plasmids Sequence DNA Which of the following is...
This PCR step is called annealing. The annealing step follows the denaturation step: it is usually the lowest temperature in the PCR. The temperature of this step varies with each PCR reaction because each primer has its own sequence and may not be an identical match to the DNA template strand. GC or CG have three hydrogen bonds and AT or TA have two hydrogen bonds. Higher annealing temperatures are more stringent and require a better match between primer and...
THANK YOU!!
Target Region Heated to 94°C DNA is denatured GGGCAACGTG CATCACTTTG Primers hybridize with template Temperature is lowered After one round of PCR the number of double-stranded DNA molecules is doubled. TGG TCACTTTGGCAAIAGAATT Heat-stable DNA polymerase adds nucleotides to the 3' end of the primer Primer 1 Primer 2 Heated to 72°C 5 TGCCTGGCCCCATCACTTTGGCAA AGAATTC 5