
The picture below shows a four-stranded b-sheet, with
the strands labeled “A” through “D”. (Note that the R-groups
have been removed.) Carbons are black; nitrogens are blue; and
oxygens are red.
A. In the box next to Strand “B”, draw an arrow showing the N-to-C
direction of the polypeptide chain.
B. What pair(s) of neighboring strands are anti-parallel?
C. What pair(s) of neighboring strands are parallel?
D. How many residues are in Strand “B”?
COULD YOU PLEASE SENT SOLUTION? IT IS IMPORTANT FOR ME. THANK YOU VERY MUCH!
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
The picture below shows a four-stranded b-sheet, with the strands labeled “A” through “D”. (Note that...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...
Suppose you were given four (4) test tubes, labeled A, B, C, and D. Each containing a colorless solution. In each of the following questions (1-3), indicate which of the solutions listed could be used to distinguish between the pairs of solutions. Use your solubility rules to help you make a choice. 1. Test tube A contains 0.1M NaNOs solution and test tube B contains 0.1M BaNOsl solution. 2. Test tube C contains 0.1M NaCl solution and test tube D contains 0.5M...