Question

Trypsin is an enzyme that cleaves on the C-terminal side (that is, to the right of)...

Trypsin is an enzyme that cleaves on the C-terminal side (that is, to the right of) all basic residues. Consider the peptide shown below. Predict the fragments that would be formed by treatment of this peptide with trypsin:
N terminal end-Leu-Lys-Asn-Asp-Thr-His-Val-Met-Cys

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
Trypsin is an enzyme that cleaves on the C-terminal side (that is, to the right of)...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved...

    5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved by trypsin? b. What are the fragments, if it is cleaved by chymotrypsin? c. What are the fragments, if it is cleaved by pepsin?

  • please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...

    please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...

  • On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments...

    On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments based on their molecular weights. Your fellow intern Jerry has neglected to label his tubes of amyloid beta peptide 42 after digesting them with some proteases that we learned about in Module 6: pepsin, trypsin, and chymotrypsin. Help him figure out what protease is in each tube. Jerry’s supervisor has the fragments listed in the same order as the original peptide primary sequence, which...

  • PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction...

    PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...

  • Thrombin is an enzyme seen in the blood clotting cascade. It cleaves proteins on the carboxyl...

    Thrombin is an enzyme seen in the blood clotting cascade. It cleaves proteins on the carboxyl side of arginine residues. How many peptide fragments would be formed if Thr-Phe-Arg-Lys-His-Pro-Arg was treated with thrombin? 3 Thrombin would not cleave this polypeptide, since there are no arginine residues. O 1 0 2

  • On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments...

    On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments based on their molecular weights. Your fellow intern Jerry has neglected to label his tubes of amyloid beta peptide 42 after digesting them with some proteases that we learned about in Module 6: pepsin, trypsin, and chymotrypsin. Help him figure out what protease is in each tube. Jerry’s supervisor has the fragments listed in the same order as the original peptide primary sequence, which...

  • Based on where CNBR and trypsin cut, evaluate the following experimental data and predict the N-...

    Based on where CNBR and trypsin cut, evaluate the following experimental data and predict the N- and C-terminal amino acids of the parent peptide (peptide before cutting). Enter your answer using the three letter amino acid abbreviations, with a comma in between. For example, if the N-terminal residue is alanine and C-terminal residue is glycine you would write: Ala, Gly. Cleavage with CNBR produced the following peptides: Gly-Ala-Lys-Leu-Pro-Met Phe-Trp-Met Asp-Gly-Arg-Cys-Ala-Gln Cleavage with trypsin: Cys-Ala-Gln Phe-Trp-Met-Gly-Ala-Lys Leu-Pro-Met-Asp-Gly-Arg

  • Thermolysin cuts on the N-terminal side of valine, isoleucine, leucine and phenylalanine. Write down the fragments...

    Thermolysin cuts on the N-terminal side of valine, isoleucine, leucine and phenylalanine. Write down the fragments formed of following polypeptide treated with this enzyme. Ala-Leu-Cys-Tyr-His-Arg-Val-Gly = ?? Chymotryspin cuts on the C-terminal side of phenylalanine, tryptophan and tyrosine. Write down the fragments formed of following polypeptide treated with this enzyme. Ala-Leu-Cys-Tyr-His-Arg-Val-Gly = ??

  • Question 13 of 19 > Suppose Kara has isolated a peptide and must determine the amino...

    Question 13 of 19 > Suppose Kara has isolated a peptide and must determine the amino acid sequence. After one cycle of Edman degradation on a sample of the peptide, she produces a phenylthiohydantoin (PTH) derivative, OH Treatment with cyanogen bromide on another sample of her peptide gives her the fragments • Lys-Pro-Ala-Met, • Pro-Asp. • Leu-Ile-Cys-Trp-Met, and • Thr-Arg.Met. She also digested a sample of her peptide with the enzyme chymotrpsin. One of the fragments produced after treatment with...

  • What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...

    What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT