Cyanogen bromide cleaves at C- terminal of methionine residues. Thus the second peptide must be in the last of the sequence because it does not have any methionine residue. Chymotrypsin cleaves C- terminal of aromatic amino acid that are W, Y, and F. So the correct order of amino acids/ peptides in this protein will be-
TRM-KPAM-LICTM-PE
Where all single letter codes are taken for the peptide here. Chymotrypsin will cleave at carboxy-terminus of tryptophan and a fragment of MPE leaves behind.
Question 13 of 19 > Suppose Kara has isolated a peptide and must determine the amino...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
How many amino acids are there in the disease causing variant of
the Amyloid-beta (Ab) peptide?
Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
A protein biochemist attempted to determine the amino acid sequence of a decapeptide. Use the results from the trypsin, chymotrypsin, and cyanogen bromide treatments to suggest the amino acid sequence of this decapeptide. Trypsin digestion gave two fragments with the following residues (not in order): T1: Ala, Arg, Phe, Pro, Thr, Trp, Tyr T2: Lys, Met, Val Chymotrypsin digestion gave three fragments with the following residues (not in order): CT1: Ala, Phe CT2: Pro, Arg CT3: Thr, Trp CT4: Lys,...
anyone can help me with it?
A protein biochemist attempted to determine the amino acid sequence of a decapeptide. Use the results from the trypsin, chymotrypsin, and cyanogen bromide treatments to suggest the amino acid sequence of this decapeptide. Trypsin digestion gave two fragments with multiple residues (not in order): • T1: Ala, Arg, Phe, Gly, Thr, Trp, Tyr • T2: Lys, Met, Val Chymotrypsin digestion gave four fragments with multiple residues (not in order): • CT1: Ala, Phe •...
Explain this question please!
Name (4 ofer to the Table of Amino Acids at the beginning of the exam to help solve this problem. Polypeptide I is a 12-mer and has the following amino acid composition: Ala, Arg, 2 His, Leu, 2 Lys, 2 Phe, Ser, Thr, Trp Edman degradation of I shows that its N-terminal amino acid is His. Chymotrypsin cleavage of I yields peptide fragments A-D.Trypsin cleavage of I gives peptide fragments E-G. Shown below is the amino...
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
Need help with #2
Clearly provide the 3-letter symbol for the correct sequence of cach amino acid in each of listings of the amino acids in the peptide or in any fragments are simply listed in alphabetical order. A subscriptive the number of that amino acid. Use parentheses to incorporate the unknown amino acids after each treatment 1. A five amino acid peptide contains: Arg. Glu, His, Phe, and Ser This peptide yields the following results when broken down into...
A peptide from a novel bacterial protein was isolated and sequenced. The amino acid sequence is NH2-Leu-Met-Pro-Tyr-Ser-Ala-Ala-Pro-Cys-Leu-Trp-Glu-Ala-Gly-Asp-Arg-COOH. To verify and clone the gene encoding this protein from this uncharacterized bacterium, a student has to purify the bacterial genomic DNA and use it as the template to isolate the DNA fragment that encodes this peptide using PCR. The student plans to design a pair of oligonucleotides as the forward and reverse primers to PCR the DNA fragment that encodes this peptide....
7. A peptide was isolated from sheep hypothalamus and subjected to sequence analysis. The experimental data are as follows. Deduce the amino acid sequence from this data. a. Composition (2Ala, 2Gly, Thr, Phe, Lys, His, Ser, Trp, Arg, Val) b. Reaction of dinitrofluorobenzene with the intact peptide yielded DNP-Thr. A brief treatment with carboxypeptidase a yielded glycine. c. Trypsin digestion yielded three fragments: i. Phe, Thr, Ala, Lys ii. Gly, Val iii. Trp, His, Ser, Gly, Arg, Ala Treatment of...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...