5. (3 pts) Determine the organization of each of the memories below given their number of...
5. (3 pts) Determine the organization of each of the memories
below given their number of address and data lines.
(a) EEPROM A17-A0,
D8-D0
(b) NV-RAM A11-A0,
D16-D0
(c) DRAM A8-A0,
D3-D0 (careful!)
Homework Answers
Add Answer to:
5. (3 pts) Determine the organization of each of the memories
below given their number of...
2. (18 pts) For each of the molecules/ions given below: a. Determine the total number of...
2. (18 pts) For each of the molecules/ions given below: a. Determine the total number of valence electrons b. Draw the Lewis structure. c. Name the elect ron-domain (VSEP R) geometry d. Name the molecular geometry and illustrate the 3D structure with bond angles if applicable. e. Indicate the hybridization of the central atom, if possible. PF3 ICl4 Brl3 NO3 ХeFz ICls
3. (5 pts) For each of the listed functions, determine a formula for the derivative function....
3. (5 pts) For each of the listed functions, determine a formula for the derivative function. For the first two, determine the formula for the derivative by thinking about the nature of the given function and its slope at various points; do not use the limit definition. For the latter three, use the limit definition, Pay careful attention to the function names and independent variables. It is important to be comfortable with using letters other than f and r. For...
3. (5 pts each) Given the following reactions, determine the following Ni2+ + 2e - →...
3. (5 pts each) Given the following reactions, determine the following Ni2+ + 2e - → Ni, E. = -0.25 V Pb2+ + 2e → Pb, Eo = -0.13 V a. Calculate the change in Gibbs free energy of the electrochemical cell. b. Calculate cell potential of a galvanic cell based where [Ni2+] = 0.030 M and [Pb2+] = 0.300 M.
7) (15 pts) Determine the relevant voltage asked for in each case below: a) (5 pts)...
7) (15 pts) Determine the relevant voltage asked for in each case below: a) (5 pts) Find the magnitude of the emf generated when a solid metal object with dimensions 12cm x 3cm x 5cm (into the page) is moving with a speed of 4m/s through a region where there is a constant 0.02T magnetic field, as shown. B 12cm 775cm 3cm b) (5 pts) Find the magnitude of the emf generated at t=2s when the magnetic flux through a...
4) Determine the mobility of each planar linkage shown below, specify the number of joints and...
4) Determine the mobility of each planar linkage shown below, specify the number of joints and members. 5) Determine the mobility of each of the planar linkages shown below. Specify the number of links and members. 6) Determine the mobility associated with the mechanism below. The round part rolls without slipping on the pieces in contact with it 7) If position information is available for all points in the planar linkage shown below, can all the velocities be determined uniquely...
Question 3 25 pts Given the circuit below, determine the average real power P supplied by...
Question 3 25 pts Given the circuit below, determine the average real power P supplied by the circuit. Give your answer as positive and in units of W. Use the following quantities: w = 744 rad/sec and Vin = 47 20°V Vout 3 mH 5 F 4002 V. 2002 25 pts U Question 4
Q#3: Given the deformation of a 4-story building shown below. Determine the allowable and design drifts...
Q#3: Given the deformation of a 4-story building shown below. Determine the allowable and design drifts of each story. (5 Pts) A: = 5 cm A: = 3.5 cm Az = 2.5 cm A: = 0.5 cm Q#4: Determine the seismic design parameters and spectrum of a site in Miami, Florida according to ASCE 7-10. The site is Class C. (5 Pts)
Question 13 5 pts Given the graph of displacement vs time below, determine the period of...
Question 13 5 pts Given the graph of displacement vs time below, determine the period of oscillation for this mass on a spring. Displacement from equilibrium vs time for a mass on a spring Displacement of the Mass from Equilibrium (m) & Time(s) Note, because Canvas often does not correctly copy images, here is a linke to the graph external to Canvas. . The period of oscillation is
9. Given the following data, determine the nu- merical value of each of the expressions below....
9. Given the following data, determine the nu- merical value of each of the expressions below. Person (i) X, 610 99/ 4 5 25 4 0 7 49 749 8 i.ΣΧ Xi 10. Given the data from Exercise 9 for X and Yan that c, a constant, equals 3, determine the nu merical value for the following expressions:
Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given...
Please solve each item in a detailed and descriptive way.
Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
2. (18 pts) For each of the molecules/ions given below: a. Determine the total number of valence electrons b. Draw the Lewis structure. c. Name the elect ron-domain (VSEP R) geometry d. Name the molecular geometry and illustrate the 3D structure with bond angles if applicable. e. Indicate the hybridization of the central atom, if possible. PF3 ICl4 Brl3 NO3 ХeFz ICls
3. (5 pts) For each of the listed functions, determine a formula for the derivative function. For the first two, determine the formula for the derivative by thinking about the nature of the given function and its slope at various points; do not use the limit definition. For the latter three, use the limit definition, Pay careful attention to the function names and independent variables. It is important to be comfortable with using letters other than f and r. For...
3. (5 pts each) Given the following reactions, determine the following Ni2+ + 2e - → Ni, E. = -0.25 V Pb2+ + 2e → Pb, Eo = -0.13 V a. Calculate the change in Gibbs free energy of the electrochemical cell. b. Calculate cell potential of a galvanic cell based where [Ni2+] = 0.030 M and [Pb2+] = 0.300 M.
7) (15 pts) Determine the relevant voltage asked for in each case below: a) (5 pts) Find the magnitude of the emf generated when a solid metal object with dimensions 12cm x 3cm x 5cm (into the page) is moving with a speed of 4m/s through a region where there is a constant 0.02T magnetic field, as shown. B 12cm 775cm 3cm b) (5 pts) Find the magnitude of the emf generated at t=2s when the magnetic flux through a...
4) Determine the mobility of each planar linkage shown below, specify the number of joints and members. 5) Determine the mobility of each of the planar linkages shown below. Specify the number of links and members. 6) Determine the mobility associated with the mechanism below. The round part rolls without slipping on the pieces in contact with it 7) If position information is available for all points in the planar linkage shown below, can all the velocities be determined uniquely...
Question 3 25 pts Given the circuit below, determine the average real power P supplied by the circuit. Give your answer as positive and in units of W. Use the following quantities: w = 744 rad/sec and Vin = 47 20°V Vout 3 mH 5 F 4002 V. 2002 25 pts U Question 4
Q#3: Given the deformation of a 4-story building shown below. Determine the allowable and design drifts of each story. (5 Pts) A: = 5 cm A: = 3.5 cm Az = 2.5 cm A: = 0.5 cm Q#4: Determine the seismic design parameters and spectrum of a site in Miami, Florida according to ASCE 7-10. The site is Class C. (5 Pts)
Question 13 5 pts Given the graph of displacement vs time below, determine the period of oscillation for this mass on a spring. Displacement from equilibrium vs time for a mass on a spring Displacement of the Mass from Equilibrium (m) & Time(s) Note, because Canvas often does not correctly copy images, here is a linke to the graph external to Canvas. . The period of oscillation is
9. Given the following data, determine the nu- merical value of each of the expressions below. Person (i) X, 610 99/ 4 5 25 4 0 7 49 749 8 i.ΣΧ Xi 10. Given the data from Exercise 9 for X and Yan that c, a constant, equals 3, determine the nu merical value for the following expressions:
Please solve each item in a detailed and descriptive way.
Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago