Question

Do an alignment matrix using PAM250 substitution matrix with a gap score of -14 for the...

Do an alignment matrix using PAM250 substitution matrix with a gap score of -14 for the sequences ANFNCFWS and ANFNNASWF.

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
Do an alignment matrix using PAM250 substitution matrix with a gap score of -14 for the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Write the alignment matrix and the resulting best alignment of the following two sequences using the...

    Write the alignment matrix and the resulting best alignment of the following two sequences using the scoring scheme: match = 2; mismatch = -1, gap penalty = -4 – gap length. The alignment matrix should have scores and trace-back arrows for every matrix element. Sequence1: TTCTCGAGACTCA Sequence2: TCTCGGACTCA

  • gatggggatac--tgtttggagcccaag gattggtacaccatattt---tactaag What is the score of the alignment using affine gap penalties with the following...

    gatggggatac--tgtttggagcccaag gattggtacaccatattt---tactaag What is the score of the alignment using affine gap penalties with the following scoring parameters? match: +5 mismatch: -4 gap opening: -16 gap extension: -4 Note that these gap opening and gap extension scores are the same as the default parameters used by the EMBOSS matcher program. Please show the solutions

  • With a match score of 3, and mismatch score of −1, and using gap penalty of...

    With a match score of 3, and mismatch score of −1, and using gap penalty of −2 a gap open penalty of −5 and a gap extention penalty of −1 what is the score of the following alignment? TCTCCTG−ACCCC TCT−−AGT−CC−−

  • Write a Matlab script to solve. Output the aligned sequences with the maximum alignment score. We...

    Write a Matlab script to solve. Output the aligned sequences with the maximum alignment score. We would like to align two DNA sequences: (v) C G A T A C T, and (w) G A T T C G T based on the following scoring scheme i) s(i, j) = 1.5 if vi = wj (matches); ii) s(i, j) = -1.0 if vi != wj (mismatches); iii) d = 0.25 (indels: insertions or deletions). D is the gap penality What...

  • In the following alignment, why do we see a gap in the sequences of the PDR1...

    In the following alignment, why do we see a gap in the sequences of the PDR1 template, the samples 5_21 and 2_21 but not in the sequence in the sample 3_22 Template PDR1 (YGL013C) TCTAGTCAACCTTTG-ATCGACGAAATCTTTGGTTTGTACTCTCC 790 800 810 820 830 790 800 810 820 830 5_215_21.ab1) wwwmiss swimsuit TCTAGTCAAACTTTG-ATCGACGAAATCTTTGGTTTGTACTCTCC 800 810 820 830 792 221 wwwww wwwwwwwM TCTAGTCAAACTTTG-ATCGACGAAATCTTTGGTTTGTACTCTCC 790 888 820 830 3_22 (3_22.ab1) MAMAMARAAMAAAAAAAAAAAAAAAAAAAAA TCTAGTCAACCTTTGAATCGACGAAATCTTTGGTTTGTACTCTCO 790 810 820 830 880

  • jnment Score: Resources Give Up? Hint Check Answer estion of 10 > Consider the two sequence...

    jnment Score: Resources Give Up? Hint Check Answer estion of 10 > Consider the two sequence alignments. Alignment 1. A-SNLFDIRLIG GSNDFYEVKIMD Alignment 2 ASNLFDIRLI-G GSNDFYEVKIMD Calculate the alignment scores of each sequence alignment using identity-based scoring and the Blosum 62 substitution matrix. The identity-based scores should incorporate a gap penalty. In this case, the Blum-62 substitution matrit does not impose a gap penalty Blosum-62 Substitution Matrix Ala Arg Asn Asp Cys Gin Glu Gly His Ile Leu Lys Met Phe...

  • Consider two homologous DNA sequences, GATTC and CCATG. Use the Needleman-Wunsch algorithm to find the optimal...

    Consider two homologous DNA sequences, GATTC and CCATG. Use the Needleman-Wunsch algorithm to find the optimal global alignment between these two sequences. Use a linear gap penalty of -4 and the substitution matrix provided below. The dynamic programming matrix is already outlined below, you just need to fill it according to the algorithm. Be sure to write out your final alignment! substitution matrix A C GT A 10 -5 0 -5 C -5 10 -5 0 G 0 -5 10...

  • Write Matlab or Python scripts to solve. Output the aligned sequences with the maximum alignment score....

    Write Matlab or Python scripts to solve. Output the aligned sequences with the maximum alignment score. We would like to align two DNA sequences: (v) C G A T A C T, and (w) G A T T C G T based on the following scoring scheme as discussed in class: i) s(i, j) = 1 if vi = wj (matches); ii) s(i, j) = 0 if vi != wj (mismatches); iii) d = 0 (indels: insertions or deletions). What...

  • The following are descriptions regarding the progressive approach for multiple sequence alignment used in Clustal algorithm....

    The following are descriptions regarding the progressive approach for multiple sequence alignment used in Clustal algorithm. Put the statements in the correct order, such that they are in the right order in the Clustal algorithm. A- The already aligned sequences are converted into a consensus sequence. A pair wise alignment is conduct for very possible pair of sequences using the Needleman Wunsch algorithm A distance matrix is generated. A guide tree is created using the information in the distance matrix....

  • 5. Biophysics 5. Based only on polarity of the amino acids (i.e., two non-identical amino acids...

    5. Biophysics 5. Based only on polarity of the amino acids (i.e., two non-identical amino acids are considered similar if they are both hydrophobic, or polar, or charged), 5. Based only on polarity of the amino acids (i.e., two non-identical A) how would you manually perform the global alignment of the two polypeptide sequences (gaps are allowed): VLLVAKKR ITSVVPKR and ILLVKKKLTTVVLPKK? B) Complete the scoring matrix for the alignment of the above sequences if a match score is 1, mismatch...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT