Monocistronic messenger RNA is the one which carries only one gene in it. Therefore during the process of translation, it uses only single reading frame so that it gives rise to single peptide sequence. If multiple reading frames will be used, then multiple peptide sequences will be formed and this occurs in polycistronic messenger RNA.
(Monocistronic messenger RNA carries single gene where polycistronic carries multiple genes. The former is present in eukaryotes and the latter is present in prokaryotes).
Please rate high.
What is the primary reason that only a single reading frame is used during translation of...
11. What effect does an insertion mutation have on the mRNA reading frame, give an example?
The images below is DNA sequence (in reading frame) and the amino add translation far a region of a protein coding gene for two species you are researching. By comparing the two alignments and or using the translation table provided (remember U = T) mark all of the mutations in the DNA alignment as either non-synonymous (N) or synonymous (S). Place either an "N" or an "S" in the space above the mutation in the DNA alignment. How many non-synonymous...
What are the potential consequences of inaccurate mRNA splicing? a. A single base error at a splice junction will cause a large deletion. b. A single base error at a splice junction will cause a large inversion. c. A single base error at a splice junction will cause a large insertion. d. A single base error at a splice junction will change the reading frame and result in mRNA mistranslation.
3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...
What determines the terminus of a protein? A stop codon in the correct reading frame. A transcription terminator in the correct reading frame. A polyA tail in the correct reading frame. The 3' terminus of the messenger RNA.
3. During translation, explain how the cell determines where to start and stop the protein synthesis when an mRNA template is given
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
#8
. Metro by T-Mobile LTE 10:40 PM 69% Done 9 of 9 Is coding strand so assume both could be the coding strand 5' - GCTAATGCACOTT - 3 3' - OGATTACGTGCAA - 5 5-CGALUAC GUGCAA - 3 3-GCUAAUGCACGUU - 5 As opposed to DNA replication or transcription, translation requires the correct reading frame. a) Use the sequence below to illustrate what the reading frame" on an mRNA refers to 5' UUGCAYUGSAGC 3' b) Write out ALL of the possible...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
4. Given the following information: One strand of a section of DNA isolated from E. coli reads 5’-GTAGCCTACCCATAGG-3’ 3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...