If you want to clone an insert into a vector at BamH1 site, which of the following inserts can you use to clone at the site
If you want to clone an insert into a vector at BamH1 site, which of the...
You are tasked to clone the human actin gene (blue) from a cDNA clone that you obtained from a collaborator into the cloning vector termed pUC119 using the HindIII restriction enzyme. The 4 blue arrows show the HindIII recognition sequence on the Actin cDNA clone. Plac MCS Hindill Sphl sbil Pst BspMI Accl Hincli Sall Xbal BamHI Smal Xmal Acc651 Kpnl Eco53ki Sacl EcoRI lacz pMB1 ori M13 IG PUC119 3162 bps CDNA Clone Amp a. b. Figure 2: a....
Suppose you want to sequence the following DNA segment: 5’-GATCTCTTGAAATG-primer site-3’ You clone the fragment into a plasmid, transform it into bacterial cells and isolate DNA from one of the bacterial colonies. You use the Sanger sequencing method to determine the sequence, separating the products from the sequencing reactions by gel electrophoresis. Draw the bands that should appear on the gel from the four sequencing reactions.
Hi! Can someone explain WHY #2 is what it is? I don't understand
where those numbers came from. In addition, can you explain where
the numbers came from on the bands on the gel in #4? Thanks!
The vector you use contains the lacZ gene and a kanamycin resistance cassette (KanR) BamH1 Lacz Ori EcoR1 ECOR1 Hindlll Vector 20kb Bgll 5kb Pst1 Pst1 7kb Q4. What enzyme will you use if you want to do a blue/white selection screen to...
This is what I was given to solve the question. Nothing else and
I don't understand anything at all.
5. You are tasked to clone the human actin gene (blue) from a cDNA clone that you obtained from a collaborator into the cloning vector termed pUC119 using the HindIII restriction enzyme. The 4 blue arrows show the HindIII recognition sequence on the Actin cDNA clone. piac CS Hindi Sphi Sofi Psti BspMI Aocl Hincll Sall Xhal BamHI Smal Xmal Acc651...
Cloning 2
Below is the restriction map of a 10 kb piece of DNA. Also shown
below is a cloning vector which has two unique restriction enzyme
recognition sites, one for EcoRI (E) and one for HindIII (H). The
location of the kanamycin (kan) and ampicillin (amp) resistance
genes is also shown. Kanamycin and ampicillin are antibiotics that
are commonly used to select transformed E. colicells (consult the
Lab Manual for more information). Note that the HindIII site is
located...
3. The pCMV-Ha vector and the DDX3 insert were cut with both EcoR1 and Sali, and then purified. Why do you think we chose to cut with two different restriction enzymes, rather than just one (e.g. only EcoR1)? (7 points)
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple cloning site ( MCS) where a gene of interest can be added so bacteria can express it as protein. The sequence of the MCS is show with the location of the restriction sites. E Xbal Sail Se Sphi Hindill GAATTCGAGCTCGGTACCOGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG SACK Smal 0 2500 lacza Polylinker 396-454 500 amp 2000 PUC19 2686 bp ori 1000 If you wanted to insert a gene into this...
What happens when vector DNA is digested with EcoRI and what
does this tell you about the number and distribution of EcoRI sites
in the vector?
How big (in base pairs) is (are ) the fragments generated by
digesting the vector with EcoRI?
V R R V & EcoR1 8 , EcoR1, R & & PST1 PST1 Size Markers R & EcoR1 4 Calf Liver Calf & EcoR1 Liver 7 6 5 3 2 1 Wells 16mm Base Pairs 6650...
1. What is the difference between an STR and a SNP? 2. Describe what an allele is, with respect to STRs. 3.Describe the simplest strategy you could use to clone the insert into the vector if you do not care about which direction it inserts. 4.Describe a second strategy that would ensure that the insert was in the proper direction.
Early gene cloning experiments involved insertion at one restriction site in the vector; for example, the insert would have and EcoRI site at each end, and he vector would be opened at an RI site prior to litigation. Under what circumstances would asymmetric cloning be desirable, with the insert having a different site at each end? Please only typed replies and provide source where information was obtained. Thanks