What would you find encoded in the mRNA of the enzyme helicase?
|
A nuclear localization signal |
||
|
A signal peptide |
||
|
Neither of the above |
||
|
Both of the above |
Answer. Both of the above because both help in translocation of the helicase enzyme from cytoplasm to the nucleus of eukaryotic cell.
What would you find encoded in the mRNA of the enzyme helicase? A nuclear localization signal...
1. How long would the peptide encoded by this bacterial mRNA be if it were translated in a eubacterial cell? 5'UAUGAGGAGGUAUGCAUGAAUCGGUAGCCUAACGGAUUCC3' ____ 2. How long would the peptide encoded by this eukaryotic mRNA be if it were translated in a eukaryotic cell? 3'-mG5'5'-GUACCAUGGCCAGGAGGUGAAUGUUCCAUGCAUCGGUAGCCUAACCAACGAUUUCUGCAAAAAAAAAAAAAAAAA3'
24.Consider a transcription regulatory protein that has both a nuclear localization and a nuclear export signal and is normally found both in the nucleus and in the cytosol at comparable concentrations. This protein has a high-affinity binding partner in the nucleus. Upon activation of a certain signaling pathway, the binding partner is ubiquitylated and degraded. As a result of this,... the transcription regulatory protein accumulates in the nucleus. the transcription regulatory protein accumulates in the cytosol. expression of its target...
what does the enzyme Helicase do in BOTH RNA and DNA? and what are the differences between the two?
What would happen if the enzyme was non-functional for Polymerase, I Polymerase III, Ligase, Helicase and Okazaki Explain please
An enzyme, encoded by gene A, converts substrate X into product Y. Individuals with a dominant mutation in gene A over accumulate substrate X, which causes severe neurological symptoms. At the molecular level, this enzyme functions as a homodimer. A homodimer is a protein composed of two subunits that are encoded by the same gene. Let’s suppose you are able to purify subunits from cell samples and then mix them together under conditions in which they form homodimers, and you...
1 pts DI Question 6 What region of this molecule shown would bind to mRNA during translation? 3' A-OH 5' A Cacceptor stem G C G- U TuC loop D-loop C U GACAC m'A GGAGAGm m' G C-G A-U variable loop Anticodon loop Cm U A Gm A A The 5' end The anticodon loop The 3 end The variable loop The acceptor stem D Question 7 1 pts What is synthesized during transcription? O a strand of tRNA O...
In an experiment comparing two cell types, you notice that YFP (your favorite protein) encoded by YFG is abundant in cell type A but undetectable in cell type B. When you checked the mRNA transcript level, you find that they are equal in both cell types. Which of the options below provides the best explanation for this difference? a. activating transcription factors contain a loss-of-function mutation in cell type B b. the chromatin in cell type B is in the...
Question 5 1 pts The enzyme helicase is an important part of the replication machinery, but its use now requires specifically the activity of the following enzyme: Topoisomerase ODNA polymerase Sliding clamp Primase Ligase Question 7 1 pts Much of replication can be studied using extracts from wild type (normal) yeast cells that supply all of the essential components. Compared to wild type extracts, if you use an extract that is missing the sliding clamp AND ligase, what do you...
15. You are examining the effects of mutations on a nuclear pore. For the following cases below, describe 1. where in the process of nuclear import function will stop 2. what is being affected and 3. if function can still occur and WHY: a. The nuclear localization signal is mutated on a nuclear protein. b. The nuclear transport receptor cannot bind to the nuclear protein. c. A limited amount of GAP is available in the cell to hydrolyze the GTP....
Please answer all questions
2 After isolating the rough endoplasmic reticulum from the rest of the cytoplasm, you purify the RNAS attached to it. Which of the following proteins do you expect the RNA from the rough endoplasmic reticulum to encode? (a) (c) soluble secreted proteins plasma membrane proteins ER membrane proteins all of the above (b) (d) -13 In which cellular location would you expect to find ribosomes translating MRNAS that encode ribosomal proteins? (a) (c) the nucleus in...