What is the purpose of finding genetic interactions of a gene? Select one: a. To find its gene clusters on chromosome b. To find if a mutation has happened in that gene c. To find possible pathways a gene might be involved in
Option B is correct
To find if mutation has happened in that gene.
Genetic interaction is defined as a deviation from the expected natural phenotype i.e., genes responds in an unnatural or different way. It causes changes in genotype and phenotype(sometimes) of the organism.
What is the purpose of finding genetic interactions of a gene? Select one: a. To find...
1 What is an imprinted gene? Select one: a. A gene that is found on a Barr body b. A gene that is silenced upon inheritance from a designated parent c. A gene that is inherited from only one parent d. A gene that is encoded on only one of the two copies of a chromosome Question 2 Which of the following is NOT a typical characteristic of cancer? Select one: a. Malignant cancers are typically not able to metastasize...
Can someone please help me with numbers 4 and 5?
A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heterozygote Dogs Assignment 2 Below are the sequences of wildtype and mutant alleles of the myostatin gene discussed in the paper introduction Wildtype Allele: AATTACTGCTCTGGAGAGTGTGAATTTGTG Mutant Allele: AATTACTGCTCTGGAGAGTGAATTTGTGTT 1) Using the genetic code table (provided on page 2) and single-letter code for amino acids, write the amino acid sequences of both predicted proteins 2) What might...
A smaller recombination frequency means (choose all that apply) Select one or more: a. Less genetic variation on that chromosome b. The genes on the chromosome do not assort independently c. The genes on the chromosome assort independently d. More genetic variation on that chromosome
3) Proto-oncogenes can be converted to oncogenes by various genetic changes. Which of these mechanisms is not likely to contribute to conversion to an oncogene? Select one: A: Extra copies of the gene are made, thereby enhancing expression. B: A mutation occurs upstream of the gene that results in a more active promoter. C: Chromosomes break and fragments are translocated from one chromosome to another. D: Point mutations occur that result in a protein more resistant to degradation. E: All...
What are the answers to both
parts
A woman has a mutation in a mitochondrial gene that encodes a subunit of the aerobic respiratory Complex IV. What percentage of her male children are expected to harbor this same mitochondrial abnormality? Mitochondrial genetic analysis of the father of these children has revealed that he does not have this genetic mutation. Choose one: O A. 100% of male children will have the mitochondrial genetic mutation. O B. 75% of male children will...
What is responsible for the genetic variation observed among offspring from the same parents? Select one: a. Independent assortment b. Gene linkage c. Recessive alleles d. Incomplete dominance
Biology Questions help me 1. Germline gene therapy would correct a genetic defect in: Select one: a. an unaffected individual only. b. an unaffected individual and his or her offspring. c. an affected individual and all of his or her descendants. d. the parents of an affected individual. 2. An antigen is: Select one: a. any molecule that can elicit an immune response. b. a protein only. c. a nucleic acid only. d. a protein or nucleic acid. 3. Performing...
1. The following is a sequence of RNA. Do you expect it to adopt any kind of structure, and, if so, show what the structure would be? 5'-AUACUGCCCCCGGGGGAUGCCCGUAAACCGGGGUUACCCGGUUUAAACGGCCCCCCGGGGGCAGGCG-3'. 2. A dipoid yeast was ABD on one chromosome and abd on the other. The yeast cell underwent meiosis and the four genomes in the resulting tetrad were analyzed and determined to be: ABD, ABD, ABD and abd. a. For the moment, focus on the outcome regarding the number of B versus...
Which of the following is TRUE of incomplete penetrance? Select one: a. Epistatic interactions can result in incomplete penetrance in some cases. b. Environmental factors do not influence penetrance. c. Incomplete penetrance implies that some individuals will experience less severe forms of disease, such as cancer or Alzheimer's. d. Incomplete penetrance is never observed with Huntington's disease e. Incomplete penetrance refers to cases in which individuals developing a particular disease (e.g., cancer or Alzheimer's) lack the typical genotype for this...
3. (35 pts) The gene for the cone photoreceptor in the eye and the gene for a blood-clotting factor are both in the X-chromosome. Suppose they are 14 map units apart. Mutation in the photoreceptor gene results in color blindness, and is inherited as an X-linked recessive trait. Mutation in the clotting factor gene results in hemophilia, and is also inherited as an X-linked recessive trait. You have two patients: Sally and Jill. Both patients have a family history of...