Question

1. Which one of the following describes the NORMAL FUNCTION of a stop codon in mRNA...

1. Which one of the following describes the NORMAL FUNCTION of a stop codon in mRNA during bacterial protein synthesis?

a. It is at the end of a mRNA molecule and terminates translation once the protein is completed.

b. It prematurely terminates protein synthesis resulting in an incomplete protein.

c. The 3 stop codons are UGA, UAG, and UGG.

2. A tRNA with an ACC anticodon will insert the amino acid ________ during translation. (Use your codon sheet, Fig. 6 in the transcription and the translation section.)

Arg

Cys

Svn

Ser

Trp

3. A tRNA with an ACC anticodon will hydrogen bond with a ______ mRNA codon. (Use your codon sheet, Fig. 6 in the transcription and the translation section.)

Stop

UGG

ACC

TGG

UCC

4. Which one of the following describes the NORMAL FUNCTION of a stop codon in mRNA during bacterial protein synthesis?        

It is at the end of a mRNA molecule and terminates translation once the protein is completed.        

It prematurely terminates protein synthesis resulting in an incomplete protein.        

The 3 stop codons are UGA, UAG, and UGG.

5. In the primary structure of a protein, the amino acids are connected to one another by ____________.        

disulfide bonds.        

congealed Yoo Hoo brand chocolate drink.        

hydrogen bonds.        

peptide bonds.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans-1- the 3 stop codon are UAA, UAG, UGA which are found at the end of mRNA and terminate the synthesis of protein.

Option A is correct.

Ans-2- anticodon ACC encodes for the amino acid tryptophan (trp).

Ans-3- a tRNA with ACC anticodon will make hydrogen bond with UGG codon.

Ans-5- amino acids are linked by peptide bond which is formed by condensation reaction between 2 amino acids.

Peptide bond is correct answer.

Add a comment
Know the answer?
Add Answer to:
1. Which one of the following describes the NORMAL FUNCTION of a stop codon in mRNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • QUESTION 11 A mutation in a bacterial gene generates a UGA stop codon in the middle...

    QUESTION 11 A mutation in a bacterial gene generates a UGA stop codon in the middle of the mRNA coding for the protein product. A second mutation in the cell leads to a single nucleotide change in a tRNA that allows the correct translation of the protein. The altered tRNA translate the UGA as tryptophan. What nucleotide change has probably occurred in the mutant tRNA molecule? a. A mutation that changes the anticodon to 5-ACI O b. A mutation that...

  • Which of the following correctly describes the process of Translation? I. tRNA anticodon bonds to mRNA...

    Which of the following correctly describes the process of Translation? I. tRNA anticodon bonds to mRNA codon II. Ribosome bonds to mRNA strand II. Ribosome reaches a STOP codon and detaches from the mRNA IV. Each tRNA adds an Amino Acid to the chain as the Ribosome moves along the mRNA V. Complimentary mRNA strand is made from DNA template OA. V, I, IV, III B. II, IV, III, I, V C. II, I, IV, III D. V, II, I,...

  • 3.  What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct...

    3.  What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct amino acid? 6. If each amino acid was encoded by a single codon, what is the minimum number of amino-acyl tRNA synthetases required for translation? 7. Looking at the codon table, if there was a unique aminoacyl-tRNA synthetase required for each anticodon, what is the minimum required? 9. If an aminoacyl-tRNA synthetase recognized any nucleotide (purine or pyrimidine) in the 5’end of the anticodon,...

  • 25. What binds to a stop codon on a mRNA during translation? a. transcription factor c....

    25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...

  • 50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...

    50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...

  • 7. Which of the following mRNA codons would form a codon- anticodon base pairing interaction with...

    7. Which of the following mRNA codons would form a codon- anticodon base pairing interaction with the 3'-UAG-5' tRNA anticodon? A) 3- ATC-5 B) 5'- GAU-3' C) 5-ATC-3' D) 3'-AUC-5 E) 5'-AUC-3'

  • Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

    Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...

  • Please explain Why is a cap added to MRNA, but not to 1RNA or RRNA? Each...

    Please explain Why is a cap added to MRNA, but not to 1RNA or RRNA? Each of the three types of RNA are transcribed by different RNA polymerases. Only RNA polymerase II, involved in mRNA synthesis, contains a domain capable of interacting with enzymes that form the cap. Transcription and processing of MRNA occur in the nucleus, where cap binding proteins are found. These proteins, which add and modify the cap, are not found in the cytoplasm, where tRNA and...

  • Associated Amino Acid: Compare your mRNA codon and tRNA anticodon with the amino acid chart provided....

    Associated Amino Acid: Compare your mRNA codon and tRNA anticodon with the amino acid chart provided. Determine which amino acid is coded for and write its name next to the corresponding number below. ① START - methionine ⑤Click or tap here to enter text. ②Click or tap here to enter text. ⑥Click or tap here to enter text. ③Click or tap here to enter text. ⑦Click or tap here to enter text. ④Click or tap here to enter text. ⑧Click...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT