Question

What portion of the TCR is in the carboxy tail and amino ends of the Alpha...

  1. What portion of the TCR is in the carboxy tail and amino ends of the Alpha Beta peptides? (Variable region or intracellular end?)
0 0
Add a comment Improve this question Transcribed image text
Answer #1
  • TCR ( T cell receptor) is the receptor molecule expressed on the surface of T cells which binds to antigenic peptides.
  • TCR is itself composed of two chains : alpha and beta, bound together by a disulfide linkage.
  • Each chain has constant and variable regions. The variable region of TCR is composed of CDRs or complementarity determining regions, which bind to antigenic peptides.
  • The CDR of alpha chain of TCR binds to N terminal (amino end) of peptide, whereas CDR of beta chain binds to C terminal (carboxy tail) of peptide.

Hence, the portion of TCR in the carboxy tail and amino ends of the alpha beta peptides is Variable region.

Add a comment
Know the answer?
Add Answer to:
What portion of the TCR is in the carboxy tail and amino ends of the Alpha...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • CAN SOMEONE VERIFY QUESTION 1 AND EXPLAIN QUESTION 2. WHAT ARE THE CARBOXY AND AMINO (N)...

    CAN SOMEONE VERIFY QUESTION 1 AND EXPLAIN QUESTION 2. WHAT ARE THE CARBOXY AND AMINO (N) ENDS AND HOW DO I RECOGNIZE THEM? WILL LEAVE RATE AND COMMENT! The following is an mRNA transcribed from a prokaryotic gene. 5’-UCAUAAGGAUGCCACCAACCGGCGGAUCAGGCCCGUGACACCUUGG-3’ 1. Write the corresponding double-stranded DNA sequence the mRNA is transcribed from. Indicate the 5’ and 3’ ends of both strands and indicate the coding and template strands.    3’-AGTATTCCTACGGTGGTTGGCCGCCTAGTCCGGGCACTGTGGAACC-5’ 2. Write the amino acid sequence of the encoded polypeptide. Indicate the...

  • 1. Draw the dipeptide His-Gly at pH 7.4. 2. Label the amino terminus, the carboxy terminus,...

    1. Draw the dipeptide His-Gly at pH 7.4. 2. Label the amino terminus, the carboxy terminus, the two alpha carbons, and the peptide bond (1pt). 3. Calculate it’s net charge. 4. What is the net charge of this dipeptide at pH = 2? 5. List the levels of protein structure and the types of bonds/interactions that are characteristic of each level.

  • Lecture 3 Identify amino-/carboxy termini, and R-group on amino acid What is chirality? Identify a carbon...

    Lecture 3 Identify amino-/carboxy termini, and R-group on amino acid What is chirality? Identify a carbon that is chiral (i.e., has 4 different groups attached) Chiral compounds rotate plane polarized light Memorize amino acid 1) structure, 2) classification (hydrophobic, aliphatic, aromatic, negatively charged, positively charged, polar uncharged) Be able to draw glycine (the generic amino acid) Given an amino acid structure and pKas of ionizable groups, be able to determine the charge at pH 1, pH 14, and pH 7...

  • 1) In a two-tail test, with an alpha of 0.01, approximately what z value separates the...

    1) In a two-tail test, with an alpha of 0.01, approximately what z value separates the region of acceptance from the region of rejection? A.   2.58 or -2.58 B.   2.33 or -2.33 2) Another name for a two sample dependent test is. A. alpha sample B. paired sample

  • which amino acids restrict alpha helical or beta pleated sheets formation, what are the properties that...

    which amino acids restrict alpha helical or beta pleated sheets formation, what are the properties that they have that make them do so.

  • The following is a portion of the amino acid sequence of human GLUT1 purified from red...

    The following is a portion of the amino acid sequence of human GLUT1 purified from red blood cells.  Glucose is also shown for your convenience. 147  151 161   171   181 vspt alrgalgtlh qlgivvqili aqvfgldsim gnkd A.  An internal 23 amino acid region of the sequence above is the 5th transmembrane domain of GLUT1.  The beginning of the sequence is an intracellular loop.  The end of the sequence is an extracellular loop.  Indicate where these regions might be in the sequence.  Explain how you derived at your hypothesis....

  • 1) Indicate why alpha helices and beta sheets help "bury" hydrophobic amino acids in the interior...

    1) Indicate why alpha helices and beta sheets help "bury" hydrophobic amino acids in the interior of a folded polypeptide in an aqueous environment. 2) Explain what is meant by the statement "Protein folding is driven by hydrophobic interactions" and under what conditions this is true.

  • a piece of eukaryotic DNA is shown below:                      5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA...

    a piece of eukaryotic DNA is shown below:                      5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA PRODCUED, IF THIS IS THE CODING STRAND? b)Assuming that after processing, a cap is added to the mRNA at the 5’ end, predict the amino-acid sequence of the protein produced from this piece of mRNA using SINGLE LETTER codes. In your answer denote both the amino and carboxy ends of the protein? THANKS FOR THE HELP.

  • 2. what is the configuration of almost all naturally occurring amino acids at the a (alpha)...

    2. what is the configuration of almost all naturally occurring amino acids at the a (alpha) carbon 3. why is an alpha amino acid such as alanine more acidic than a regular carboxyllic acid 4. strecker synthesis Formation dl-phenylalanine 5. outline the steps to synthesize the simple dipeptide AL (think about two amino acids that begin with an A and an L) 6. give the structure and name of the nucleosides in dna and rna 7. give the structure of...

  • Question 10 (4 points) Although all protein structures are unique, there are common structural building blocks...

    Question 10 (4 points) Although all protein structures are unique, there are common structural building blocks that are referred to as regular secondary structures, Some proteins have alpha-helices, some have beta-sheets, and still others have a combination of both. What makes it possible for proteins to have these common structural elements? 12 15 a) the hydrophobic-core interactions. b) hydrogen bonds that form along (alpha helices) or between (beta sheets) polypeptide backbones. c) side-chain interactions d) specific amino acid sequences. 7...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT