Hence, the portion of TCR in the carboxy tail and amino ends of the alpha beta peptides is Variable region.
What portion of the TCR is in the carboxy tail and amino ends of the Alpha...
CAN SOMEONE VERIFY QUESTION 1 AND EXPLAIN QUESTION 2. WHAT ARE THE CARBOXY AND AMINO (N) ENDS AND HOW DO I RECOGNIZE THEM? WILL LEAVE RATE AND COMMENT! The following is an mRNA transcribed from a prokaryotic gene. 5’-UCAUAAGGAUGCCACCAACCGGCGGAUCAGGCCCGUGACACCUUGG-3’ 1. Write the corresponding double-stranded DNA sequence the mRNA is transcribed from. Indicate the 5’ and 3’ ends of both strands and indicate the coding and template strands. 3’-AGTATTCCTACGGTGGTTGGCCGCCTAGTCCGGGCACTGTGGAACC-5’ 2. Write the amino acid sequence of the encoded polypeptide. Indicate the...
1. Draw the dipeptide His-Gly at pH 7.4. 2. Label the amino terminus, the carboxy terminus, the two alpha carbons, and the peptide bond (1pt). 3. Calculate it’s net charge. 4. What is the net charge of this dipeptide at pH = 2? 5. List the levels of protein structure and the types of bonds/interactions that are characteristic of each level.
Lecture 3 Identify amino-/carboxy termini, and R-group on amino acid What is chirality? Identify a carbon that is chiral (i.e., has 4 different groups attached) Chiral compounds rotate plane polarized light Memorize amino acid 1) structure, 2) classification (hydrophobic, aliphatic, aromatic, negatively charged, positively charged, polar uncharged) Be able to draw glycine (the generic amino acid) Given an amino acid structure and pKas of ionizable groups, be able to determine the charge at pH 1, pH 14, and pH 7...
1) In a two-tail test, with an alpha of 0.01, approximately what z value separates the region of acceptance from the region of rejection? A. 2.58 or -2.58 B. 2.33 or -2.33 2) Another name for a two sample dependent test is. A. alpha sample B. paired sample
which amino acids restrict alpha helical or beta pleated sheets formation, what are the properties that they have that make them do so.
The following is a portion of the amino acid sequence of human GLUT1 purified from red blood cells. Glucose is also shown for your convenience. 147 151 161 171 181 vspt alrgalgtlh qlgivvqili aqvfgldsim gnkd A. An internal 23 amino acid region of the sequence above is the 5th transmembrane domain of GLUT1. The beginning of the sequence is an intracellular loop. The end of the sequence is an extracellular loop. Indicate where these regions might be in the sequence. Explain how you derived at your hypothesis....
1) Indicate why alpha helices and beta sheets help "bury" hydrophobic amino acids in the interior of a folded polypeptide in an aqueous environment. 2) Explain what is meant by the statement "Protein folding is driven by hydrophobic interactions" and under what conditions this is true.
a piece of eukaryotic DNA is shown below: 5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA PRODCUED, IF THIS IS THE CODING STRAND? b)Assuming that after processing, a cap is added to the mRNA at the 5’ end, predict the amino-acid sequence of the protein produced from this piece of mRNA using SINGLE LETTER codes. In your answer denote both the amino and carboxy ends of the protein? THANKS FOR THE HELP.
2. what is the configuration of almost all naturally occurring amino acids at the a (alpha) carbon 3. why is an alpha amino acid such as alanine more acidic than a regular carboxyllic acid 4. strecker synthesis Formation dl-phenylalanine 5. outline the steps to synthesize the simple dipeptide AL (think about two amino acids that begin with an A and an L) 6. give the structure and name of the nucleosides in dna and rna 7. give the structure of...
Question 10 (4 points) Although all protein structures are unique, there are common structural building blocks that are referred to as regular secondary structures, Some proteins have alpha-helices, some have beta-sheets, and still others have a combination of both. What makes it possible for proteins to have these common structural elements? 12 15 a) the hydrophobic-core interactions. b) hydrogen bonds that form along (alpha helices) or between (beta sheets) polypeptide backbones. c) side-chain interactions d) specific amino acid sequences. 7...