Question

Perl

Write a program to calculate the reverse complement of a strand of DNA. Do not # use the s/// or the tr functions. Use the substr function, and examine each base one at # a time in the original while you build up the reverse complement. (Hint: you might # find it easier to examine the original right to left, rather than left to right, although # either is possible.)

Answer 1

#!/usr/bin/perl -w
# Calculating the reverse complement of a strand of DNA

# The DNA
$DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

# Print the DNA onto the screen
print "Here is the starting DNA:\n\n";

print "$DNA\n\n";

# Calculate the reverse complement
#
# First, copy the DNA into new variable $revcom 
# 
$revcom = reverse $DNA;

#
# Next substitute all bases by their complements,
# A->T, T->A, G->C, C->G
#

$revcom =~ s/A/T/g;
$revcom =~ s/T/A/g;
$revcom =~ s/G/C/g;
$revcom =~ s/C/G/g;

# Print the reverse complement DNA onto the screen
print "Here is the reverse complement DNA:\n\n";

print "$revcom\n";

#
# Oh-oh, that didn't work right!
# Our reverse complement should have all the bases in it, since the
# original DNA had all the bases--but ours only has A and G!
#
# Do you see why?
#
# The problem is that the first two substitute commands above change
# all the A's to T's (so there are no A's) and then all the
# T's to A's (so all the original A's and T's are all now A's).
# Same thing happens to the G's and C's all turning into G's.
#

print "\nThat was a bad algorithm, and the reverse complement was wrong!\n";
print "Try again ... \n\n";

# Make a new copy of the DNA (see why we saved the original?)
$revcom = reverse $DNA;

# See the text for a discussion of tr///
$revcom =~ tr/ACGTacgt/TGCAtgca/;

# Print the reverse complement DNA onto the screen
print "Here is the reverse complement DNA:\n\n";

print "$revcom\n";

print "\nThis time it worked!\n\n";

exit;