Question

ASSIGNMENT For the DNA sequence given below, write the complementary DNA sequence that would complete the...

ASSIGNMENT

  1. For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand.  

DNA    3’—A   T   T  G   C   T   T   A  C   T   T  G   C   A   T -- 5’

DNA    5’--

  1. Does it matter which strand is the ‘code strand’? The following two sequences look identical, except one runs 3’-5’ and the other 5’-3’. For each DNA sequence given below, write the mRNA sequence that would be coded from it. Make sure you indicate the direction of each mRNA strand (i.e. 3’ and 5’ ends).  Use the Universal triplet code to determine the sequence of amino acids that would be generated for each of the mRNA sequences that you generated in question 2. Remember that the reading of mRNA goes in the 5’-3’ direction (see lab notes for examples).
  1. To make the mRNA, read from LEFT TO RIGHT → →

To make the amino acid, read triplets from Left to Right.

DNA         3’- T A C C T A C T T T G C C C G A T C C A T– 5’

mRNA  5’---

amino acid

b.  Read letter by letter from RIGHT TO LEFT

      To make the amino acid, read triplets from Left to Right

DNA         5’- T A C C T A C T T T G C C C G A T C C A T– 3’

mRNA  5’---

amino acid

  1. Are the amino acid sequences in a and b the same?     YES____          NO____
  1. What 3’ to 5’ DNA sequence would correspond to a 5’-AUG-3’ start codon?

RNA 5’— A   U   G—3’

DNA   3’--________--5’

  1. Read the DNAsequence given below in the 3’ to 5’ direction and circle all of thepotentialstart codons (i.e. every time you see the DNA version of a start codon- as in answer to question 3).

How many potentialstart codons did you find?_______________

Line

YOUR DNA SEQUENCE (read from left to right)

1

1) 3’- T T C C G T A A C T T C G G C G C A T C T A G C T T G A G C T C C A A T C A G G

2

2) A C T A C T T A T A A A A A T C T T C T C G A G A G A G C T T T A C T C C T A C T C

3

3) T C T T A G T C G A T T C C A T C G G A C C T A C G A T T G A C A A G C G C G G T C

4

4) T A C T A T C T A C T T A T T T A T T T A C G A G C G T T G A T T C T A C C T A C T G

5

5) A C G A C T A G G G C A T T C T A T A G G A T T A A C T C C T T A T T T T A A C T A

6

6) A C T T C C T G G G A A G G C G C C T T T A T C T G A T C C G T A A T C C G T C C G

7

7) A A G G C T C T G A T C G G A T T A C T G G G T C A C T G G A A A G T G A C C G C T

8

8) G T C T A T T A C T G T A T T T C A T C T G A T T G A C T A T T T T A T A G T C G -5’

  1. Now find and circle the promoter region 3’-TATAAAA -5’ in yoursequence above.
  2. Identify the start codon that is immediately downstream (towards the 5’ end, after the promoter) of the promoter. Indicate the codons that follow the start, and continue until you reach a stop codon.

  1. Copy the entire coding sequence that is found in question 4 (from, and including the start codon to the stop codon). Hint: there are 19 codons, each with 3 base pairs, and the coding region is between lines 2 and 4.

DNA:  3’ –

__ __ __    __ __ __   __ __ __    __ __ __    __ __ __   __ __ __    __ __ __    

__ __ __    __ __ __   __ __ __    __ __ __    __ __ __   __ __ __    __ __ __   

__ __ __   __ __ __    __ __ __    __ __ __   __ __ __ -5’

  1. Now write down the mRNA sequence that would be generated from the DNA sequence from question 7. Hint: there are 19 codons, each with 3 base pairs.

mRNA: 5’-

__ __ __    __ __ __   __ __ __    __ __ __    __ __ __   __ __ __    __ __ __    

__ __ __    __ __ __   __ __ __    __ __ __    __ __ __   __ __ __    __ __ __   

__ __ __   __ __ __    __ __ __    __ __ __   __ __ __ - 3’

  1. Finally write out the sequence of amino acids that the mRNA sequence in question 8 would code for. Hint: there are 18 amino acids (including the start/methionine). Use the Universal Triplet code from the Gene Expression tutorial document.

Amino acid sequence:______-______-_______-_______-______-_____-______-______-______-______-______-______-______-______-______-______-______-______

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Template strand 3’- A   T   T  G   C   T   T   A  C   T   T  G   C   A   T - 5’

Coding strand 5’- T    A A C G    A A   T G   A   A C   G T    A -3’

  • 5’ to 3’ strand of DNA serve as coding strand.
  • 3’ to 5’ strand of DNA act as template strand.
  • RNA polymerase recognizes specific sequences in promotes region and binds to template strand.
  • RNA is synthesized by complementary base pairing with the template strand. Coding strand serve as reference.
  • Thus, the RNA will have same sequence as coding strand (only T is replaced by U) and is oriented in 5’ to 3’ direction.

a.

Template strand:  3’- T A C C T A C T T T G C C C G A T C C A T-5’

Coding strand   : 5’- A T G G A T G A A A CG G G C T A G G T A-3’

mRNA: 5’- AUG GAU GAA ACG GGC UAG G U A-3’

Amino acid:       Met-Asp-Glu- Thr-Ala

b.  

Coding DNA strand: 5’- T A C C T A C T T T G C C C G A T C C A T– 3’

mRNA:          5’- UAC CUA CUU UGC CCG AUC CAU– 3’

Amino acid: Tyr-Leu- Leu- Cys-Pro-Pro-Ile-Leu

No. Amino acid sequences from a and b are not same.

RNA 5’- A  U  G -3’

DNA   3’- T A C -5’

Add a comment
Know the answer?
Add Answer to:
ASSIGNMENT For the DNA sequence given below, write the complementary DNA sequence that would complete the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using...

    INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'....

  • INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using...

    INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3P-A TIGOTTACTTGCA T-5° DNA 5'- 2) Does it matter which strand is the 'code strand"? The following two sequences look identical, except one runs 3'-5' and the other 5'-3'. For...

  • Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...

    Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...

  • 2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...

    2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • 3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND...

    3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...

  • A strand of DNA has the base sequence GATTCA

    3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...

  • I have my own answers, i just want to check my work, thanks! Given the DNA...

    I have my own answers, i just want to check my work, thanks! Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...

  • DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...

    DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...

  • Read the DNAsequence given below in the 3’ to 5’ direction and circle all of thepotentialstart...

    Read the DNAsequence given below in the 3’ to 5’ direction and circle all of thepotentialstart codons (i.e. every time you see the DNA version of a start codon- as in answer to question 3). How many potentialstart codons did you find?_______________ Line YOUR DNA SEQUENCE (read from left to right) 1 3’- T T C C G T A A C T T C G G C G C A T C T A G C T T G...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT