How many potentialstart codons did you find?_______________
|
Line |
YOUR DNA SEQUENCE (read from left to right) |
|
1 |
3’- T T C C G T A A C T T C G G C G C A T C T A G C T T G A G C T C C A A T C A G G |
|
2 |
A C T A C T T A T A A A A A T C T T C T C G A G A G A G C T T T A C T C C T A C T C |
|
3 |
T C T T A G T C G A T T C C A T C G G A C C T A C G A T T G A C A A G C G C G G T C |
|
4 |
T A C T A T C T A C T T A T T T A T T T A C G A G C G T T G A T T C T A C C T A C T G |
|
5 |
A C G A C T A G G G C A T T C T A T A G G A T T A A C T C C T T A T T T T A A C T A |
|
6 |
A C T T C C T G G G A A G G C G C C T T T A T C T G A T C C G T A A T C C G T C C G |
|
7 |
A A G G C T C T G A T C G G A T T A C T G G G T C A C T G G A A A G T G A C C G C T |
|
8 |
G T C T A T T A C T G T A T T T C A T C T G A T T G A C T A T T T T A T A G T C G -5’ |
DNA: 3’ –
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ -5’
mRNA: 5’-
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ - 3’
Amino acid sequence:______-______-_______-_______-______-_____-______-______-______-______-______-______-______-______-______-______-______-______
There are 6 potentialstart codon, TAC is the potential start codon.
mRNA is complimentary to DNA, and mRNA has Uracil(U) in place of Thiamine(T) .
In case of amino acid every codon of mRNA codes for an amino
acid.

Read the DNAsequence given below in the 3’ to 5’ direction and circle all of thepotentialstart...
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'....
ASSIGNMENT For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3’—A T T G C T T A C T T G C A T -- 5’ DNA 5’-- Does it matter which strand is the ‘code strand’? The following two sequences look identical, except one runs 3’-5’ and the other 5’-3’. For each DNA sequence given below, write the mRNA sequence that would be coded from it. Make sure you indicate the direction of each mRNA strand (i.e. 3’ and 5’ ends). Use the Universal triplet code to...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
QUESTION 7 If the MC1R protein is 317 amino acids long why are there 954 base pairs in the coding region of the gene? Each amino acid has a mRNA codon and DNA triplet consisting of a three-base sequence. (317 x 3951 plus a stop codon (951-3-954) to signal the end of translation) Because there are 317 proteins in the MC1R code. mutant proteins always have 954 base pairs. Each amino acid has a mRNA codon and DNA triplet consisting...
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
1.) In which direction is RNA transcribed?
2.) Which of the two strands (A or B) serves as the TEMPLATE
strand for the transcription of a mRNA that contains both a start
and a stop codon?
3.) Which number (1, 2, 3, 4, or 5) best approximates the
location of the -10 consensus sequence?
4.) How many amino acids long is the protein encoded by the mRNA
from this DNA sequence?
5.) What is the second...
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
Genetics! help please
May S Tae suumissis hot be accepted. 1. (10 points) A series of tRNAs have the anticodon sequences shown below Considering wobble, use Figure 13.12 to determine the possible codons with which each tRNA could pair Posible codons (Indicate the s end of each codon) Anticodon sequence 5-ACG-3 5'-xm UmGG-3 5'-IGA-3' Indicate which amino acid would be covalently bonded to tRNAs with the anticodon sequences given above. Use Table 13.1 to help you with your answer. Anticodon...
TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...