Question

Complete the following Algorithm Workbench Question. Use properly aligned pseudocode format when implementing your proposed solution:...

Complete the following Algorithm Workbench Question. Use properly aligned pseudocode format when implementing your proposed solution:

Q) Draw a flowchart showing the general logic for finding the highest value in an array.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer is as follows :

Flow chart for finding largest no. in array :

This flowchart shows the computer algorithm for finding the largest number in a list of numbers. Basically it gets the first number in the list and assumes it is the largest. It is put into the "largest" variable. Then it looks at each number in the list. If the number it is looking at is larger, it becomes the largest. There are N numbers so i goes from 0 to N-1. In the end, the variable "largest" holds the largest number.

if there is any query please ask in comments..

Add a comment
Know the answer?
Add Answer to:
Complete the following Algorithm Workbench Question. Use properly aligned pseudocode format when implementing your proposed solution:...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • C# QUESTION Requirements Your task is to write a program that will print out all the s of the com...

    C# QUESTION Requirements Your task is to write a program that will print out all the s of the command line arguments to a program For example, given the arguments 'gaz, wx,and 'edc, your program should output wsxaazea Your implementation is expected to use Heap's algorithm according to the following pseudocode: procedure generatelk: integer, A: array of any): if k 1 then output A) else // Generate permutations with kth unaltered //Initially k length(A) // Generate permutations for kth swapped...

  • Answer the following question: A Multi Level Feedback (MLF) algorithm uses 5 priority levels. All levels...

    Answer the following question: A Multi Level Feedback (MLF) algorithm uses 5 priority levels. All levels are using Round Robin (RR) Scheduling algorithm with Quantum: 1 ms, 2 ms, 4 ms, 8 ms, 16 ms respectively. Processes start at highest priority (Q=1) and is down graded to the lower priority if it didn't finish within 1 quantum. The following processes are to be scheduled: Arrival Io Wait 0 3 Process P1 P2 P3 CPU Burst 2 4 15 4 1...

  • In this assessment, you are required to program an Algorithm-based agent to solve a real-world, which is a challenging case study. This assessment is done individually, and you are required to submit programs and supporting documents in report format. Ple

    You are required to create a robot path planner that is able to find an optimal path to navigate an environment and reach a target. By completing this assessment, you will show your skills on leveraging the best algorithm to solve a simplified real-world problem.The maze can be seen in the image below. It can be seen that there are 12 rows and 24 columns, meaning there is a total of 288 blocks on the map. There are four different...

  • Requirement Write pseudocode and translate it to ONE C-program for each the following problems. In your...

    Requirement Write pseudocode and translate it to ONE C-program for each the following problems. In your pseudocode and C-program, use only what you have learned in this class so far. (Menu) Design a menu for question 2 and 3. So far, you use one program to solve all lab questions. But some of you may feel awkward when you want to demo/test only one lab question. To overcome that, your program should show a menu so that the users of...

  • Use a sheet of paper to answer the following question When complete, take a picture of...

    Use a sheet of paper to answer the following question When complete, take a picture of your answer and attach the file to this assignment. The reaction of (2S)-2-chloro-3-methylpentane with sodium iodide yields two products: () 2R)-2-iodo-3- methylpentane, (2) racemic 3-iodo-2-methylpentane. Draw mechanisms to account for the formation of each of these products, giving explanations to support your mechanistic rationale.

  • complete the following in c++ programming code and answer question 3. use question 2 below as...

    complete the following in c++ programming code and answer question 3. use question 2 below as reference 2. If your nameArray variable is sorted using Bubble Sort Algorithm, it will go through a several pass-throughs and characters will be swapped in each pass-through, until nameArray gets completed sorted (alphabetically ascending order). Show all these stages (Passes and iterations within Passes) for your nameArray. Based on our example, here is a sample of how I want you to write these steps:...

  • Please Complete the following C Code with Comments explaining your solution and post a screenshot of...

    Please Complete the following C Code with Comments explaining your solution and post a screenshot of it working. Summary: This project explores pattern matching techniques to find a pattern in a DNA sequence containing letters in the DNA alphabet {A, C, G, T}. For example, suppose we have a DNA sequence as follows: ATGACGATCTACGTATGGCAGCCACGCTTTTGATGTTAAGTCACACAGCCAAGTCA ACAAGGGCGACTTCATGATCTTTCCGCTCCGTTGGTGTAGGCCCGTGTTCAAATTC AATGGCTGATTGGAATTACCTTTGAAATACTCCAACCGACCGCCACGGCCAGGGT CCCGCTCGCTCTCTGTGGCCCTCCCACAAAACTCCGGTGAAAGTTGATTTGGACAC GGACCCAAAGCAGCGTAGATTATTCGAGCGTATTCGGTAGTCATTGAGGCCCCAA The pattern “AATGG” can be found at the beginning of the third line. Note that overlapping matches are counted individually. For example,...

  • Question 2: Finding the best Scrabble word with Recursion using java Scrabble is a game in...

    Question 2: Finding the best Scrabble word with Recursion using java Scrabble is a game in which players construct words from random letters, building on words already played. Each letter has an associated point value and the aim is to collect more points than your opponent. Please see https: //en.wikipedia.org/wiki/Scrabble for an overview if you are unfamiliar with the game. You will write a program that allows a user to enter 7 letters (representing the letter tiles they hold), plus...

  • Question2 uses structured design implemented in C. Array of records (structs) with file I/O is needed....

    Question2 uses structured design implemented in C. Array of records (structs) with file I/O is needed. The program takes two inputs at a time. The name of a person, and, the coin value as an integer in the range 5 to 95. Input coin values should always be divisible by 5 (integer division). Names are one word strings. An example input is: Jane 30 This input line indicates that 30 cents change is to be given to Jane. Output change...

  • CSC 142 Music Player You will complete this project by implementing one class. Afterwards, your program...

    CSC 142 Music Player You will complete this project by implementing one class. Afterwards, your program will play music from a text file. Objectives Working with lists Background This project addresses playing music. A song consists of notes, each of which has a length (duration) and pitch. The pitch of a note is described with a letter ranging from A to G.   7 notes is not enough to play very interesting music, so there are multiple octaves; after we reach...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT