Question

PLEASE DESCRIBE THE STEPS IN THE CODE! please.. (simple code) In this homework, the rail fence...

PLEASE DESCRIBE THE STEPS IN THE CODE! please.. (simple code)


In this homework, the rail fence cipher is written in Python. We did implement this already in the class by appending letters sequentially to three different lists, which represented three rails. In this project, you are allowed to implement it in any other way. First step is to drop all the space characters inside the plain text. An easy way to implement it is to notice that the first rail has the letters of a given plain text at the indices 0, 4, 8, ... and the second rail has the letters at indices 1, 3, 5, ...., and lastly the third rail has the letters at indices 2, 6, 10, .... . Feel free to define your own functions, name them as you want. As an example your program can take a plain text “THE ONLY BLUE MARBLE OF OURS” and can produce the cipher text

“Tnlaeu
holbumrloor
eyebfs”.

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
PLEASE DESCRIBE THE STEPS IN THE CODE! please.. (simple code) In this homework, the rail fence...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Part 3: Transposition Ciphers #can't use ord or chr functions You must implement three transposition ciphers...

    Part 3: Transposition Ciphers #can't use ord or chr functions You must implement three transposition ciphers (the "backwards" cipher, the Rail Fence cipher, and the Column Transposition cipher) where the ciphertext is created via an altered presentation of the plaintext. The algorithm for each is detailed in the function descriptions in this section. (13 points) def backwards_cipher(plaintext, key): • Parameter(s): plaintext ----- a string; the message to be encrypted key ----- an integer; the number to control this cipher •...

  • in python would you please help me to keep this code as in a simple and...

    in python would you please help me to keep this code as in a simple and easy code to follow please I want the code to run like first line of the letters ['B', 'C', 'D', 'BC', 'CB', 'BD', 'BCB', 'CBD', 'BCBD'] ['B', 'BC', 'BCB', 'BCBD', 'C', 'CB', 'CBD', 'BD', 'D'] word="BCBD" lst=[] for i in range(len(word)): for j in range(i+1,len(word)+1): if word [i:j] not in lst: lst.append(word[i:j]) print(lst)

  • Written in python programming for MyProLab :) Please use simple code Assume the availability of a...

    Written in python programming for MyProLab :) Please use simple code Assume the availability of a function called printStars. The function receives an integer value as an argument. If the argument is positive, the function prints (to standard output) the given number of asterisks. Thus, if printStars(8) is called, ******** (8 asterisks) will be printed. Assume further that the variable starCount has been declared and initialized with an integer value, possibly negative or zero. Write some code that does nothing...

  • PLEASE CODE IN PYTHON Run-length encoding is a simple compression scheme best used when a data-set...

    PLEASE CODE IN PYTHON Run-length encoding is a simple compression scheme best used when a data-set consists primarily of numerous, long runs of repeated characters. For example, AAAAAAAAAA is a run of 10 A’s. We could encode this run using a notation like *A10, where the * is a special flag character that indicates a run, A is the symbol in the run, and 10 is the length of the run. As another example, the string KKKKKKKKKKKKKBCCDDDDDDDDDDDDDDDKKKKKMNUUUGGGGG would be encoded...

  • Please write code using Python. Rubric Assignment Solution Total: 100 pts Program successfully retrieves and validates...

    Please write code using Python. Rubric Assignment Solution Total: 100 pts Program successfully retrieves and validates user input 15 pts Morse Code Function Created 10 pts Function Uses Parameters to get input message 15 pts Function successfully converts passed message to Morse Code and returns the Morse Code equivalent of message 45 pts Program calls Morse Code function and outputs the result of the function (i.e. the actual Morse Code) 15 pts Main Function Requirement Part 2 MUST have a...

  • C Program In this assignment you'll write a program that encrypts the alphabetic letters in a...

    C Program In this assignment you'll write a program that encrypts the alphabetic letters in a file using the Vigenère cipher. Your program will take two command line parameters containing the names of the file storing the encryption key and the file to be encrypted. The program must generate output to the console (terminal) screen as specified below. Command Line Parameters Your program must compile and run from the command line. The program executable must be named “vigenere” (all lower...

  • Please Complete the following C Code with Comments explaining your solution and post a screenshot of...

    Please Complete the following C Code with Comments explaining your solution and post a screenshot of it working. Summary: This project explores pattern matching techniques to find a pattern in a DNA sequence containing letters in the DNA alphabet {A, C, G, T}. For example, suppose we have a DNA sequence as follows: ATGACGATCTACGTATGGCAGCCACGCTTTTGATGTTAAGTCACACAGCCAAGTCA ACAAGGGCGACTTCATGATCTTTCCGCTCCGTTGGTGTAGGCCCGTGTTCAAATTC AATGGCTGATTGGAATTACCTTTGAAATACTCCAACCGACCGCCACGGCCAGGGT CCCGCTCGCTCTCTGTGGCCCTCCCACAAAACTCCGGTGAAAGTTGATTTGGACAC GGACCCAAAGCAGCGTAGATTATTCGAGCGTATTCGGTAGTCATTGAGGCCCCAA The pattern “AATGG” can be found at the beginning of the third line. Note that overlapping matches are counted individually. For example,...

  • **DO IT AS PYTHON PLEASE** The Trifid Cipher General Problem Description The Trifid cipher (not to be confused with the...

    **DO IT AS PYTHON PLEASE** The Trifid Cipher General Problem Description The Trifid cipher (not to be confused with the creatures from the classic science-fiction film "The Day of the Triffids") is an algorithm that enciphers a plaintext message by encoding each letter as a three-digit number and then breaking up and rearranging the digits from each letter's encoded form. For this assignment, you will create a set of Python functions that can encode messages using this cipher (these functions...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT