A person is found to have a genetic mutation in an enzyme. Because of the mutation...
A person is found to have a genetic mutation in an enzyme. Because of the mutation the enzyme may (Blank)
Homework Answers
Add Answer to:
A person is found to have a genetic mutation in an enzyme.
Because of the mutation...
Suppose that a person has a mutation in a gene that encodes an enzyme responsible for...
Suppose that a person has a mutation in a gene that encodes an enzyme responsible for the production of histamine. In this person, mast cells cannot produce and secrete histamine. Which of the following outcomes is most likely to happen if an injury occurs? a. Neutrophils will not be able to phagocytose pathogens at the injury site. b. Neutrophils will not be attracted to the injury site. c. Macrophages will not be able to secrete signaling molecules. d. Macrophages will...
A cell from a different person is found to have a mutation in the protein coding...
A cell from a different person is found to have a mutation in the protein coding region resulting in Rb being unable to bind to the Cyclin/CDK complex. Would this mutation lead to an increased risk of cancer? Please explain in 1-2 sentences PROCESS: THE G, CHECKPOINT IS SUBJECT TO SOCIAL CONTROL Cyclin Cyclin Inactivating phosphate Cyclin Cak G, checkpoint passed Cyclin Cyclin Cdk Activating phosphate S-phase Growth factors Rb ATP ADP 1. Growth factors arrive from other cells. 2....
Because the genetic code is nonoverlapping, a missense mutation (from a single nucleotide change) results in...
Because the genetic code is nonoverlapping, a missense mutation (from a single nucleotide change) results in the alteration of ______________, and the resulting protein has ______________. a) only one codon / at least three amino acid changes b) three codons / a single amino acid change c) only one codon / a single amino acid change d) three codons / three amino acid changes
2. The gene from question 1 is found to be mutated in a genetic disorder. The mutation is highlighted below in yellow....
2. The gene from question 1 is found to be mutated in a genetic disorder. The mutation is highlighted below in yellow. (The normal sequence is above.) CGTGGATCCAGAATTCTATATACTAGCTAAGATGGCCGGATTCGCTTTGGGAAGAATTCGGATCC GCACCTAGGTCTTAAGATATATGATCGATTCTACGGGCCTAAGCGAAACCCTTCTTAAGCCTAGG Explain how this mutation could potentially be corrected using a technique described in this module. TABLE 3.1 COMMON RESTRICTION ENZYMES Source Restriction Site Enzyme Create Cohesive Ends A A·G·C·T-T HindⅢ 5 3' A-A-G-C T-T T-T-C-G-A A G-A-A-T-T-C G A-A-T-T-C EcoRI5 C-T-T-A-A G GvG-A-T.С.С G G-A-T-C- 3' BamH 5 3 C-C-T-A G-G...
Qcode Bio 200 3-1 Funitis is a recessive genetic condition caused by a mutation in the...
Qcode Bio 200 3-1 Funitis is a recessive genetic condition caused by a mutation in the FUN gene resulting in a non- functional ion protein channel. If the FUN gene is found on the X chromosome of a heterozygous woman (assume this person has 2 X chromosomes), how would you expect expression to be different than if the gene was on an autosome? Please explain in 1 sentence or less.
About 8% of the population has a particular genetic mutation. Suppose 100 people are randomly selected...
About 8% of the population has a particular genetic mutation. Suppose 100 people are randomly selected and the number with the particular genetic mutation are counted. Find the mean number of people who will have the genetic mutation in such groups of 100 people. Find the variance of the number of people who will have the genetic mutation in such groups of 100 people. Round answer to 2 decimal places. Find the standard deviation of number of people who will...
A mutation occurs in the operator of the Lac Operon. Because of this mutation, the Lac...
A mutation occurs in the operator of the Lac Operon. Because of this mutation, the Lac Repressor is unable to bind to the operator. If a bacterial cell contained this mutation, would the Lac operon be transcribed at a high rate (be on) or off under the following conditions: Write on or off in the blank next to each of the conditions. + glucose + lactose ________ + glucose - lactose ________ - glucose + lactose ________ - glucose -...
Recent news articles have discussed the connection between a rare genetic mutation and breast cancer in...
Recent news articles have discussed the connection between a rare genetic mutation and breast cancer in women. One of the companies offering this BRCA genetic test is Quest, and this company claims a 97.5% accuracy rate. In the general population about 1 in 390 people would actually carry this BRCA1 genetic mutation. Hint: Construct a table as in your course materials. Use a population size of 39000 women. What is the likelihood that someone does not have the BRCA mutations,...
Using these types of genetic changes: Base substitution, Transition, Transversion, Missense mutation, Nonsense mutation, Insertion, Deletion,...
Using these types of genetic changes: Base substitution, Transition, Transversion, Missense mutation, Nonsense mutation, Insertion, Deletion, Frameshift mutation Label these genetic changes (a-e). More than one answer may apply to each answer. a. GC->CG in the protein coding region on a gene. b. GC->TA in a GAA glutamate codon c. Loss of three bases GAA for a glutamate codon d. GC->CG in a tRNA gene e. GC->AT in the ribosome binding site of a mRNA
Question 5 1 pts There is a genetic condition in which the enzyme at #1 is...
Question 5 1 pts There is a genetic condition in which the enzyme at #1 is non-functional. What would be the result of this condition? a. The person would not be able to store glucose as glycogen b. The person would not be able to store glucose as fat c. The person would have a difficult time increasing blood sugar between meals d. The person would be suffering from diabetes e. The person would not be able to eat excess...
A cell from a different person is found to have a mutation in the protein coding region resulting in Rb being unable to bind to the Cyclin/CDK complex. Would this mutation lead to an increased risk of cancer? Please explain in 1-2 sentences PROCESS: THE G, CHECKPOINT IS SUBJECT TO SOCIAL CONTROL Cyclin Cyclin Inactivating phosphate Cyclin Cak G, checkpoint passed Cyclin Cyclin Cdk Activating phosphate S-phase Growth factors Rb ATP ADP 1. Growth factors arrive from other cells. 2....
2. The gene from question 1 is found to be mutated in a genetic disorder. The mutation is highlighted below in yellow. (The normal sequence is above.) CGTGGATCCAGAATTCTATATACTAGCTAAGATGGCCGGATTCGCTTTGGGAAGAATTCGGATCC GCACCTAGGTCTTAAGATATATGATCGATTCTACGGGCCTAAGCGAAACCCTTCTTAAGCCTAGG Explain how this mutation could potentially be corrected using a technique described in this module. TABLE 3.1 COMMON RESTRICTION ENZYMES Source Restriction Site Enzyme Create Cohesive Ends A A·G·C·T-T HindⅢ 5 3' A-A-G-C T-T T-T-C-G-A A G-A-A-T-T-C G A-A-T-T-C EcoRI5 C-T-T-A-A G GvG-A-T.С.С G G-A-T-C- 3' BamH 5 3 C-C-T-A G-G...
Qcode Bio 200 3-1 Funitis is a recessive genetic condition caused by a mutation in the FUN gene resulting in a non- functional ion protein channel. If the FUN gene is found on the X chromosome of a heterozygous woman (assume this person has 2 X chromosomes), how would you expect expression to be different than if the gene was on an autosome? Please explain in 1 sentence or less.
Question 5 1 pts There is a genetic condition in which the enzyme at #1 is non-functional. What would be the result of this condition? a. The person would not be able to store glucose as glycogen b. The person would not be able to store glucose as fat c. The person would have a difficult time increasing blood sugar between meals d. The person would be suffering from diabetes e. The person would not be able to eat excess...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago