Question

describe how your laboratory technique aided or hindered your ability to recover the dna sample efficiently.

describe how your laboratory technique aided or hindered your ability to recover the dna sample efficiently.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

DNA extraction has considerably evolved in recent decades.

Main methods for DNA extraction from human blood samples :

  • Solution-based DNA extraction methods
  • Solution-based DNA extraction methods using organic solvents
  • Solution-based DNA extraction methods using salting out
  • Solid-phase DNA extraction methods
  • DNA extraction methods using silica and silica matrices
  • DNA extraction using anion exchange resins
  • DNA extraction methods using magnetic beads

Choosing the appropriate methods is crucial.

With advancements in laboratory techniques DNA extraction and recovery became easier as new toolkits were available for the same.

Add a comment
Know the answer?
Add Answer to:
describe how your laboratory technique aided or hindered your ability to recover the dna sample efficiently.
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • describe how you prepare the following laboratory sample a) solid b)liquid

    describe how you prepare the following laboratory sample a) solid b)liquid

  • RNA polymerases lack proofreading ability. Define proofreading ability and describe its importance in replication of DNA...

    RNA polymerases lack proofreading ability. Define proofreading ability and describe its importance in replication of DNA genomes.    a. What advantage might its absence give RNA viruses like SARS-CoV-2? Following protein synthesis, RNA genome and proteins assemble to form virus particles that then bud into the endoplasmic reticulum (ER) lumen and then on to the Golgi apparatus. Next, they are transported via Golgi vesicles to the cell membrane, where they are released via exocytosis. Define ER, Golgi apparatus, and exocytosis,...

  • Please describe the technique thoroughly and give examples of proteins that would be involved in ...

    Please describe the technique thoroughly and give examples of proteins that would be involved in the analysis. Limitations/advantages? how do you differentiate or if its good for small or large amino acids? Protein Analysis: For each of the techniques, we covered you should understand the basics of what the technique can be used to discover SDS-Page/ coomassie blue Western blot (focus on the part after SDS-PAGE) Protease Digestion & Mass Spec Crystallography Edman Degradation NMR I may ask you to...

  • How would you use separation techniques to recover acetone, 4-carboxyazobenzene, 1-propanol, and cumene in a laboratory...

    How would you use separation techniques to recover acetone, 4-carboxyazobenzene, 1-propanol, and cumene in a laboratory experiment. Techniques learned are: Solvent recrystallization, thin layer chromatography, column chromatography, liquid-liquid extraction, distillation. (Would prefer not to do a distillation as this times a long time). Your company has designed a new process to dye rubbers. The process uses cumene to swell the material allowing the organic dye 4-carboxyazobenzene to penetrate more easily. The resulting rubber is able to retain its color, and...

  • Describe how the ability to speak multiple languages has impacted your experiences throughout the pharmacy school....

    Describe how the ability to speak multiple languages has impacted your experiences throughout the pharmacy school. Also how will this effect as a career as pharmacist and community? ( please need to write an essay for pharmacist school)

  • Describe how each stage in the listening process influences your ability to send and share messages....

    Describe how each stage in the listening process influences your ability to send and share messages. Think of a time when you heard the words someone said, but you interpreted them differently than was intended. what happened? how did you resolve the misunderstanding?.

  • 1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It...

    1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...

  • Describe how the five problem-solving barriers might or might not affect your ability to solve this...

    Describe how the five problem-solving barriers might or might not affect your ability to solve this problem. “Imagine that you are running late for a job interview and you spill coffee on the front of your only clean shirt just before you walk out the door. It is important to make a good first impression with the panel who will be interviewing you. What should you do?”

  • 1- How do you determine the concentration of your purified DNA sample? What is spectrophotometry? What...

    1- How do you determine the concentration of your purified DNA sample? What is spectrophotometry? What are the basic principles of spectrophotometry? 2- What is the purpose of determining the A260/A280 ratio? 3- At what wavelength of light does DNA maximally absorb? 4- Explain Gel electrophoresis. How does it work? How is it useful?

  • d)Describe how to prepare a coffee sample for HPLC test ? Chemical Technique/Test a-Glucosidase with Barfoed...

    d)Describe how to prepare a coffee sample for HPLC test ? Chemical Technique/Test a-Glucosidase with Barfoed Test Casein Hydrolysis Test Osazone Test Benedict's Test Seliwanoff's Test (for sucrose) Sudan IV test High-Performance Liquid Chromatography (HPLC) Relative Absorbance Intensity 5 10 15 20 25 30 Time (minutes) Question 2. a) From the table, choose only 3 tests to distinguish between 3 coffee samples: - First one contains decaffeinated coffee 0.3 mg/L Chlorogenic Acids Second one contains 4.5 mg/L coffee, Sucrose, lactose...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT