Question

What is going to happen with the BRIC economies? Will they replace the previous economic powerhouses?...

What is going to happen with the BRIC economies? Will they replace the previous economic powerhouses? Will they be replaced by other emerging economies at some point in the future? When and by whom?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The BRIC acronym was coined by Goldman Sachs chief economist Jim O'Neill in 2001. He predicted four emerging economies - Brazil, Russia, India and China - were on their way to reshape the world economy.

Opponents said the countries were too different culturally and socially to be grouped together and that ultimately, it was a Goldman Sachs marketing ploy.Still, in the first decade, the countries met all expectations and beyond. Investment banks, think tanks and academia capitalized on the successes and everyone was talking about BRIC. In 2010, the group added South Africa, making its acronym BRICS.

The countries went from less than 20% of the world's GPD in 2003 to about 30% 10 years later. China and India were growing exponentially, while rising commodity prices kept Brazil and Russia in good pace to meet O'Neill's predictions.

But shortly after the financial crisis, external factors combined with serious internal turmoil proved too much for the group. While China and India are growing steadily today, Russia and Brazil have gone in the opposite direction.

Potential for the future
The IMF has done some research on the slowdown in the developing world.

A significant part of it reflects weaker international demand for their exports and government policies in the countries themselves becoming a restraint on growth as they reversed earlier stimulus policies - cutting spending or raising taxes to reduce borrowing needs.

But there are also factors that affect emerging economies' capacity to grow in the future - that constrain what the IMF calls their "potential growth".

Interest rates are likely to rise gradually from their current ultra low levels in the rich countries - particularly in the US and the UK.That will affect global rates and make investment more expensive to finance in emerging economies.Many also have to contend with ageing populations and slower growth in the number of people of working age.For some that demographic advantage they had previously is now fading.

Russia and China are among that group. That was factored into the Goldman Sachs projections. It is to be noted that more recently their policies in this area have been "surprisingly good".

China is easing its one child policy and, he says, "Russia has had some success in raising life expectancy with much smarter policies about alcohol consumption."

While all the Brics have slowed this decade, the weakest performers now are Brazil and Russia.Their average growth rates have been below the Asian Brics all along and this year they slowed even further.

They are showing some cracks for sure, and, to change the metaphor, China in particular is embarking on a high-wire journey as it seeks a different and perhaps ultimately more sustainable form of economic development.The Brics and how they perform matter for the rest of the world, more so than they did at the turn of the century, which is after all the whole point of the original idea.

If BRICS is to remain relevant over the next decade, each of its members must make a realistic assessment of the initiative's opportunities and inherent limitations.

BRICS did well in its first decade to identify issues of common interests and to create platforms to address these issues. However, new political realities require the BRICS nations to recalibrate their approach and to recommit to their founding ethos.

For one, they must reaffirm their commitment to a multipolar world that allows for sovereign equality and democratic decision-making. Only by doing so can they address the asymmetry of power within the group and in global governance generally. Only this approach will strengthen multilateralism.

Second, they must build on the success of the NDB and invest in additional BRICS institutions. It will be useful for BRICS to develop an institutional research wing, along the lines of the OECD, which can offer solutions distinct from western-led knowledge paradigms and which is better suited to the developing world.

Third, they should consider a BRICS-led effort to meet their commitments under the Paris Agreement on climate change and the UN's sustainable development goals. This could include, for example, setting up a BRICS energy alliance and an energy policy institution. Similarly, the NDB in partnership with other development finance institutions could be a potent vehicle to finance progress towards the sustainable development goals amongst the BRICS members.

Fourth, the BRICS nations can also consider expanding the remit of their cooperation to address emerging areas of global governance such as outer space, the oceans and the internet.

Finally, the BRICS members must encourage direct interactions between their constituents. In the digital age, seamless conversations amongst people, business and academia can foster relationships, which are more likely to cement the future of this alliance than any government efforts.

For the first decade of its existence, the group was powered by a top-down approach with large investments of political capital. The second decade must ride on the energy and entrepreneurship of the citizens and communities that reside within the BRICS countries.

Impact of MINTs (replaced when and by whom)

MINT (Mexico, Indonesia, Nigeria, Turkey) is an acronym that refers to a group of countries with the potential to realize rapid economic growth. The specific countries were selected based on specific demographic, geographic, and economic factors. The acronym is similar to the term BRIC, which refers to the economies of Brazil, Russia, India, and China. MINT was originally coined by Fidelity Investments, the well-known asset management firm, and was popularized by Jim O'Neill, a British economist with Goldman Sachs and who also had created the term BRIC.

Understanding MINTs (Mexico, Indonesia, Nigeria, Turkey)

MINT is an acronym that refers to four countries: Mexico, Indonesia, Nigeria, and Turkey. The investment firm Fidelity selected these countries in 2011 as a group that they expected would show strong growth and provide high returns for investors over the coming decade. The grouping was based on various factors such as the countries’ large populations, favorable demographics, and their emerging economies. When compared to the BRIC countries (Brazil, Russia, India, and China), MINTs have noticeably smaller economies. BRIC is a group of emerging-market economies that enjoyed strong growth for a number of years. As the BRIC countries’ growth slowed (with the exception of China), investors turned their attention to MINTs, which analysts touted to be the next countries with a rapidly growing economy.

Despite their prospects for ranking in the top 10 global economies by 2050, MINTs are far from guaranteed profitable investment. MINTs still suffer from corruption and political instability, Many have experienced significant problems in the past. For example, Turkey faced an economic crisis around the year 2000, and the International Monetary Fund bailed the country out in 2001. Despite the upheaval, analysts consider the country a viable investment, particularly since Turkey implemented changes specifically designed to prevent the recurrence of the problems that originally led to the crisis.

Requirements for MINTs

Fidelity used a variety of qualifying factors when selecting countries ripe for economic investment. Some qualities are common among all the MINTs, for example, a young population, which makes for a strong workforce typifies MINTs. MINTs also have legal systems and regulations that favor business growth, as well as governments that maintain a pro-economic growth stance. Fidelity chose countries that were geographically well-positioned for trade and countries that were not overly dependent on a single industry. Fidelity included Nigeria, for example, because of its natural resources, large population, well-regulated and well-capitalized banks, and opportunities to expand retail credit. Fidelity included Indonesia because the firm considered the country's large workforce to be a significant economic asset.

Fidelity also focused on counties that it believes may become major exporters of both raw and finished goods in the future although Nigeria, Mexico, and Indonesia are already major oil exporters. Investors hope that MINTs will prove to be as savvy an investment as the BRICs and show strong growth in GDP and stock prices.

Add a comment
Know the answer?
Add Answer to:
What is going to happen with the BRIC economies? Will they replace the previous economic powerhouses?...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 28. Refer to Figure 14-13. If the price is $2 in the short run, what will happen in the long run? a. Individual f...

    28. Refer to Figure 14-13. If the price is $2 in the short run, what will happen in the long run? a. Individual firms will earn positive economic profits in the short run, which will entice other firms to enter the industry b. Individual firms will earn negative economic profits in the short run, which will cause some firms to exit the industry. c. Because the price is below the firm's average variable costs, the firms will shut down. d....

  • Two like charges are separated by some distance. Describe quantitatively what will happen to the force...

    Two like charges are separated by some distance. Describe quantitatively what will happen to the force exerted by one charge on the other if one of the charges is replaced by a charge of the same magnitude but opposite sign. The force will become: the same magnitude but becomes attracting. not enough information to tell what will happen. twice as large. the same - no change at all. the same magnitude but becomes repelling.

  • Write a program that replace repeated three characters in a string by the character followed by 3...

    Write a program that replace repeated three characters in a string by the character followed by 3. For example, the string aabccccaaabbbbcc would become aabc3ca3b3cc. When there are more than three repeated characters, the first three characters will be replaced by the character followed by 3. You can assume the string has only lowercase letters (a-z). Your program should include the following function: void replace(char *str, char *replaced); Your program should include the following function: void replace(char *str, char *replaced);...

  • a. Suppose that the rest of the world goes through an economic recession. Show graphically and explain what happens to e...

    a. Suppose that the rest of the world goes through an economic recession. Show graphically and explain what happens to exchange rates and net exports. b. If we assume that there are two economies that are trading parties. When one of them goes through an economic recession show graphically how this business cycle is transmitted to the other country. c. Following the Great Recession the U.S. Federal Reserve decreased interest rate targets drastically. Show graphically and explain what happens to...

  • These questions please! Question 3 (1 point) What would happen without the government's protection of property...

    These questions please! Question 3 (1 point) What would happen without the government's protection of property rights? U Businesses would have less incentive to provide goods and services There would be less government regulation of businesses and prices would be lower for consumers. U Taxes would be lower, causing less market inefficiencies U Businesses would have more freedom with production processes Question 4 (1 point) What does inflation cause? incomes to fall productivity to increase the government to lower taxes...

  • Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence...

    Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary

  • What are some of the other methodological challenges the economic analyst face when conducting evaluations of public health interventions?

    What are some of the other methodological challenges the economic analyst face when conducting evaluations of public health interventions?

  • 1. What will happen to a ductile material when tensile stress on it is increased beyond...

    1. What will happen to a ductile material when tensile stress on it is increased beyond its yield strength? 2. Consider a 1 m long massless rod with a 500 g metal ball attached to one of its ends. What is its moment of inertia about the other end, assuming the metal ball to be a point mass?

  • What are three (3) economic concepts that you think you will remember from this "Micro Economics"...

    What are three (3) economic concepts that you think you will remember from this "Micro Economics" course, (long) after the quarter is over? I am looking for you to first identify and describe a concept, and then further discuss a specific way in which you will likely be able to apply the concept in your own life in at some point the future. Please divide them into three paragraph. Thank you!

  • 2) What were some of the key challenges they encountered? How did they overcome them? 3)...

    2) What were some of the key challenges they encountered? How did they overcome them? 3) What were some of the key takeaways they learned to use in the future? When I assumed the leadership of Heinz’s Asia/Pacific business, in 1993, the company’s revenues from that part of the world were hardly a blip—and I’d never visited most of the countries in the region. I made my first trip there soon after I took the job, and it really opened...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT