How does light activate pDawn vector and initiate DNA polymerase expression? Can you use intense white...
How does light activate pDawn vector and initiate DNA polymerase expression? Can you use intense white light instead of blue light?
Homework Answers
Pdawn vector contains blue light sensing protein named as YFI and once blue light is exposed, YFI will be inactive and if blue light is not exposed YFI phosphorylates FixJ Protein that will bind with the Fixk2 promoter which involves in transcription of repressor protein cl. If repressor protein is formed it will bind with the promoter of target gene and will not the DNA polymerase or RNA polymerase to bind and the expression is stopped
Yes intense white light that has nearby spectrum wavelength to the blue light also can activate pdawn
Add Answer to:
How does light activate pDawn vector and initiate DNA polymerase
expression? Can you use intense white...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
You are interested in cloning a particular segment of DNA and wish to use a commercial...
You are interested in cloning a particular segment of DNA and wish to use a commercial cloning vector with a BamHI cloning site. However, your segment of DNA does not contain the appropriate restriction site. Discussing your problem with a colleague they suggest using PCR to address your problem. How can you use a PCR reaction to facilitate a successful cloning?
i honestly have no idea how to answer this one. can someone please help me out with a thorough answer so that i can lea...
i honestly have no idea how to answer this one. can someone
please help me out with a thorough answer so that i can learn from
it as well.
You have a forward primer that anneals within sticky fingers and a reverse primer that anneals within the Pen-tag (see pictures below). Xba1 EcoR1 Xho1 Sal1 Pst1 Tbd1 ReversePen-tag Forward primer 40 Sticky fingers e) We used blue white selection to figure out which colonies of E.col had our insert in...
Here is a DNA sequence obtained from sequencing. Does this sequence code for a gene? How can...
Here is a DNA sequence obtained from sequencing. Does this sequence code for a gene? How can you tell? Is this a eukaryotic or prokaryotic gene? How can you tell? If it does code for a gene, what is the protein sequence encoded by this DNA sequence? Explain how you can tell. Are there any regulatory regions encoded by this DNA sequence? How can you tell?TTATGTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGTTATGTTACTGACAGAGGAAGACAAAAGGTTGTTTCCATAACTGACACAACAAATCAGAAGACAGAGTTACAAGCAATTCATCTAGCTTTGCAGGATTCGGGATCAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGGATCATTCAAGCACAACCAGATAAAAGTGAATCAGAGTTAGTTAGCCAAATAATAGAGCAGTTAATAAATAAGGAAAAGATCTACCTGGCATGGGTACCAGCACATAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTTAGTGCTGGAGTCAGGAAAGTATAGTTT
For this problem, your answer can be a numerical expression and does not need to be...
For this problem, your answer can be a numerical expression and does not need to be fully evaluated. For example, you could write 5⋅23+45⋅23+4. A basket contains nine red balls numbered 1, 2, 3, 4, 5, 6, 7, 8, and 9 and nine blue balls numbered 1, 2, 3, 4, 5, 6, 7, 8, and 9. a) A sample of nine balls are drawn from the basket without replacement. How many distinct samples are possible (assuming that order does not...
Can anyone help me? Use DNA model kits to construct the DNA molecule. You may need...
Can anyone help me?
Use DNA model kits to construct the DNA molecule. You may need to combine at least two groups to have all the pieces needed. Notice the formation of double helix. How does this happen?
What happens when vector DNA is digested with EcoRI and what does this tell you about...
What happens when vector DNA is digested with EcoRI and what
does this tell you about the number and distribution of EcoRI sites
in the vector?
How big (in base pairs) is (are ) the fragments generated by
digesting the vector with EcoRI?
V R R V & EcoR1 8 , EcoR1, R & & PST1 PST1 Size Markers R & EcoR1 4 Calf Liver Calf & EcoR1 Liver 7 6 5 3 2 1 Wells 16mm Base Pairs 6650...
POST-LAB QUESTIONS 1. Based on the results of the three tests, how do you kno the fruit was DNA and not protein? Explai...
POST-LAB QUESTIONS 1. Based on the results of the three tests, how do you kno the fruit was DNA and not protein? Explain. 2. What happened to the egg white sample, containing mostly protein, when you heated it or oered the pH? Explain what you saw and what you think was happening at the molecular level. 3. Why does the DNA double helix unravel when exposed to high temperatures or acidic conditions? If you tried to run this experiment with...
Can you please explain step by step how to solve these type of questions please. White...
Can you please explain step by step how to solve these type of
questions please.
White light is a mixture of all colors with wavelengths between 400 and 700m. If we shine white light on two narrow slits spaced 1 x 10 m apart and place a screen 3 m behind the slits, we will see sn interference pattern a little different from the one we saw in DL. Notice that every wavelenght of light has its n = 0...
How can you use cox1 sequence to identify the species from which a DNA sample was...
How can you use cox1 sequence to identify the species from which a DNA sample was taken?
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
i honestly have no idea how to answer this one. can someone
please help me out with a thorough answer so that i can learn from
it as well.
You have a forward primer that anneals within sticky fingers and a reverse primer that anneals within the Pen-tag (see pictures below). Xba1 EcoR1 Xho1 Sal1 Pst1 Tbd1 ReversePen-tag Forward primer 40 Sticky fingers e) We used blue white selection to figure out which colonies of E.col had our insert in...
Can anyone help me?
Use DNA model kits to construct the DNA molecule. You may need to combine at least two groups to have all the pieces needed. Notice the formation of double helix. How does this happen?
What happens when vector DNA is digested with EcoRI and what
does this tell you about the number and distribution of EcoRI sites
in the vector?
How big (in base pairs) is (are ) the fragments generated by
digesting the vector with EcoRI?
V R R V & EcoR1 8 , EcoR1, R & & PST1 PST1 Size Markers R & EcoR1 4 Calf Liver Calf & EcoR1 Liver 7 6 5 3 2 1 Wells 16mm Base Pairs 6650...
POST-LAB QUESTIONS 1. Based on the results of the three tests, how do you kno the fruit was DNA and not protein? Explain. 2. What happened to the egg white sample, containing mostly protein, when you heated it or oered the pH? Explain what you saw and what you think was happening at the molecular level. 3. Why does the DNA double helix unravel when exposed to high temperatures or acidic conditions? If you tried to run this experiment with...
Can you please explain step by step how to solve these type of
questions please.
White light is a mixture of all colors with wavelengths between 400 and 700m. If we shine white light on two narrow slits spaced 1 x 10 m apart and place a screen 3 m behind the slits, we will see sn interference pattern a little different from the one we saw in DL. Notice that every wavelenght of light has its n = 0...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago