You are a new research assistant in a lab which is heavily involved in sequencing projects. So much, in fact, that the previous run that came off the sequencer was improperly labeled as Sample A. Your PI askes you to investigate the sequence, and write up some of the findings below.
TGGAAGACCCAAGTACCTTGTTATTAACGGTGATGAGGGAGAACCAGGAACATGCAANNTAGGGAGATCGTGAAATCCTGCGCCATGATCCACACAAACTTATCGAAGGTTGCTTGATTGCTGGCAGAGCTTGGTGGTGGTGGTGGTGGTGGTGGCCCCTACATTCGTGGTGAATTCTACAATGAGGCATCCAACACTCAAGTTTGCTGAAGCTTACCAAGCTGGTTTGCTAGGAAAGAATGCCTGTGGATCTGGTTATGATTTTGATGTCTTTGTGCAAAGAGGAGCTGTACATCTGTGGTGAAGAGACTGCACTGATTGAGTCCATCGAGGGAAAGCAAGGAAAGCCAAGACTAAAGCCACCTTTCCCAGCTGATGTTGGTCTGTTTGGTTGCCCCACAACTNNNNNNNNNGTCACCAATGTCGAGACCGTTGCTGTGGCACCAGCAATCTGCAGACGCGGAGGCACGTCCTTCGGTCGGCCGCGTAACAGTGGAACCAAGCTGTACAACATCTCGGGACATGTCAACAATCCATGCACTGTGGAAGAAGAGATGTCCATACCTCTGAAGGAGTTGATCGAAAGACACGCTGGTGGTGTGATTGGAGGTTGGGATAATCTTTTGGGAATCATTCCTGGTGGCTCATCCATTTTAGTCATTCCAAAGGCCATCTGTGACACAGTGCTGATGGACTATGACGACCTCGTCAGAGTGCAGAGTTCCTTTGGTACTGCAGCTATCATTGTTATGAATAAGCAAACTGNNNNAATCAAAGCAATTGCACGTCTT
Answer:
Based on the BlastN (Nucleotide) search results:
The closest match is Nasonia vitripennis NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa (Ndufv1) which corresponds to Organism Nasonia vitripennis (jewel wasp)
Human Orthologs:
To determine human orthologs for given sequence, the search database used is Human genomic plus transcript.
You are a new research assistant in a lab which is heavily involved in sequencing projects....
CASE 20 Enron: Not Accounting for the Future* INTRODUCTION Once upon a time, there was a gleaming office tower in Houston, Texas. In front of that gleaming tower was a giant "E" slowly revolving, flashing in the hot Texas sun. But in 2001, the Enron Corporation, which once ranked among the top Fortune 500 companies, would collapse under a mountain of debt that had been concealed through a complex scheme of off-balance-sheet partnerships. Forced to declare bankruptcy, the energy firm...
Case: Enron: Questionable Accounting Leads to CollapseIntroductionOnce upon a time, there was a gleaming office tower in Houston, Texas. In front of that gleaming tower was a giant “E,” slowly revolving, flashing in the hot Texas sun. But in 2001, the Enron Corporation, which once ranked among the top Fortune 500 companies, would collapse under a mountain of debt that had been concealed through a complex scheme of off-balance-sheet partnerships. Forced to declare bankruptcy, the energy firm laid off 4,000...