Question

You are a new research assistant in a lab which is heavily involved in sequencing projects....

You are a new research assistant in a lab which is heavily involved in sequencing projects. So much, in fact, that the previous run that came off the sequencer was improperly labeled as Sample A. Your PI askes you to investigate the sequence, and write up some of the findings below.

TGGAAGACCCAAGTACCTTGTTATTAACGGTGATGAGGGAGAACCAGGAACATGCAANNTAGGGAGATCGTGAAATCCTGCGCCATGATCCACACAAACTTATCGAAGGTTGCTTGATTGCTGGCAGAGCTTGGTGGTGGTGGTGGTGGTGGTGGCCCCTACATTCGTGGTGAATTCTACAATGAGGCATCCAACACTCAAGTTTGCTGAAGCTTACCAAGCTGGTTTGCTAGGAAAGAATGCCTGTGGATCTGGTTATGATTTTGATGTCTTTGTGCAAAGAGGAGCTGTACATCTGTGGTGAAGAGACTGCACTGATTGAGTCCATCGAGGGAAAGCAAGGAAAGCCAAGACTAAAGCCACCTTTCCCAGCTGATGTTGGTCTGTTTGGTTGCCCCACAACTNNNNNNNNNGTCACCAATGTCGAGACCGTTGCTGTGGCACCAGCAATCTGCAGACGCGGAGGCACGTCCTTCGGTCGGCCGCGTAACAGTGGAACCAAGCTGTACAACATCTCGGGACATGTCAACAATCCATGCACTGTGGAAGAAGAGATGTCCATACCTCTGAAGGAGTTGATCGAAAGACACGCTGGTGGTGTGATTGGAGGTTGGGATAATCTTTTGGGAATCATTCCTGGTGGCTCATCCATTTTAGTCATTCCAAAGGCCATCTGTGACACAGTGCTGATGGACTATGACGACCTCGTCAGAGTGCAGAGTTCCTTTGGTACTGCAGCTATCATTGTTATGAATAAGCAAACTGNNNNAATCAAAGCAATTGCACGTCTT

  1. Find any orthologs in humans to your top hit reference sequence, and list their accession numbers and Uniprot ID.
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

Based on the BlastN (Nucleotide) search results:

The closest match is Nasonia vitripennis NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa (Ndufv1) which corresponds to  Organism Nasonia vitripennis (jewel wasp)

Human Orthologs:

To determine human orthologs for given sequence, the search database used is Human genomic plus transcript.

  • Homo sapiens NADH:ubiquinone oxidoreductase core subunit V1 (NDUFV1), transcript variant 1 (Accession ID: NM_007103.3)
  • Homo sapiens NADH:ubiquinone oxidoreductase core subunit V1 (NDUFV1), transcript variant 2 (Accession ID: NM_001166102.1)
Add a comment
Know the answer?
Add Answer to:
You are a new research assistant in a lab which is heavily involved in sequencing projects....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • CASE 20 Enron: Not Accounting for the Future* INTRODUCTION Once upon a time, there was a...

    CASE 20 Enron: Not Accounting for the Future* INTRODUCTION Once upon a time, there was a gleaming office tower in Houston, Texas. In front of that gleaming tower was a giant "E" slowly revolving, flashing in the hot Texas sun. But in 2001, the Enron Corporation, which once ranked among the top Fortune 500 companies, would collapse under a mountain of debt that had been concealed through a complex scheme of off-balance-sheet partnerships. Forced to declare bankruptcy, the energy firm...

  • Case: Enron: Questionable Accounting Leads to CollapseIntroductionOnce upon a time, there was a gleaming...

    Case: Enron: Questionable Accounting Leads to CollapseIntroductionOnce upon a time, there was a gleaming office tower in Houston, Texas. In front of that gleaming tower was a giant “E,” slowly revolving, flashing in the hot Texas sun. But in 2001, the Enron Corporation, which once ranked among the top Fortune 500 companies, would collapse under a mountain of debt that had been concealed through a complex scheme of off-balance-sheet partnerships. Forced to declare bankruptcy, the energy firm laid off 4,000...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT