Question

How long, in base pairs, should your PCR product be? In other words, should it be...

How long, in base pairs, should your PCR product be? In other words, should it be the exact length of the gene? Why or why not? cite source

0 0
Add a comment Improve this question Transcribed image text
Answer #1

PCR product can be of any length less than or equal to the gene size. The size of the amplicon depends on the primer designing region withing the gene. The distance between the primers in base pairs along with primer length is the total size of the gene.

No, it's not compulsory that amplicon should be of same size that of gene size. Anywhere within the gene sequence the the forward and reverse primer an be designed which is recommended to be greater than 200 bp. The usual range of PCR Product size is 200 to 10000 bp.

Source: 5 years of self expertise with PCR.

But for your needful you may cite Butler et al., 2012

Add a comment
Know the answer?
Add Answer to:
How long, in base pairs, should your PCR product be? In other words, should it be...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • If you design a primer that is 23 base pairs long and you have a genome...

    If you design a primer that is 23 base pairs long and you have a genome of 3.2 x 109 bp. How many theoretical recognition sites are there for that primer assuming even G, C, A, T, ratios and no repetitive regions of DNA? Should this yield a single, unique PCR product?

  • B. To examine whether the PCR was successful, you ran an agarose gel. The expected length of your...

    Solution please B. To examine whether the PCR was successful, you ran an agarose gel. The expected length of your targeted gene was 1,200 base pairs (BP) Lane 10,000 BP | - 4,000 BP 2,000 BP 800 BP : 400 BP A C 1. What were bands A, B, and C? (1 pt) B. To examine whether the PCR was successful, you ran an agarose gel. The expected length of your targeted gene was 1,200 base pairs (BP) Lane 10,000...

  • Gene X is 3000 base pairs in length. How many CODONS make up this GeneX? (1...

    Gene X is 3000 base pairs in length. How many CODONS make up this GeneX? (1 pt) How many amino acids would be in the protein coded for by Gene X? (1 pt) The protein coded for by Gene Y is 100 amino acids in length. How many base pairs are in Gene Y2 (1 pt) How many codons would be in Gene Y? (1 pt) Gene Z is 360 base pairs in length. How many amino acids are in...

  • 1 2 3 4 5 6 7 8 You are using a PCR assay to genotype...

    1 2 3 4 5 6 7 8 You are using a PCR assay to genotype the ACE2R gene, which is the receptor for SARS-CoV2. People who have a full-length version of ACE2R will have a band that is 700 base pairs long, whereas people who have a deletion in ACE2R have band that is 400 base pairs long. Each lane represents PCR from a different person. Which lanes represent people who are heterozygous - i.e. have both the deleted...

  • Cystic fibrosis gene is 300,000 base pairs long. The transcribed portion of the gene spans 250,000...

    Cystic fibrosis gene is 300,000 base pairs long. The transcribed portion of the gene spans 250,000 base pairs of DNA. The cytoplasmic mRNA for this gene is 6500 bases long. The protein is 1480 amino acids long. The sum of bases coding for introns is approximately:

  • In the PCR exercise you described why we amplify the 16s ribosomal RNA gene. What other...

    In the PCR exercise you described why we amplify the 16s ribosomal RNA gene. What other genes might help us to identify specific bacteria? In other words, what traits could be sequenced that are unique to bacteria?

  • You PCR amplify a 500 bp (base pairs) piece of DNA that has diagnostic value in...

    You PCR amplify a 500 bp (base pairs) piece of DNA that has diagnostic value in determining whether a patient has a mutation within a specific DNA region. You know that this DNA segment of the “normal” gene does not include an EcoRI restriction site; but the mutated DNA segment of the same gene contains an EcoRI restriction site due to a point mutation at the 100th bp from the 5’ DNA end. After PCR amplification, you subject your DNA...

  • Find the forward and reverse primer at 68 degrees C. How many base pairs will the...

    Find the forward and reverse primer at 68 degrees C. How many base pairs will the PCR product be that is generated by using these primers? How many amino acids is the predicted protein encoded by this open reading frame? Here's the complete genome of SARS coronavirus >Genome ATGTTTATTTTCTTATTATTTCTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATGATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTTTACTATCCTGATGAAATTTTTAGATCAGACACTCTTTATTTAACTCAGGATTTATTTCTTCCATTTTATTCTAATGTTACAGGGTTTCATACTATTAATCATACGTTTGGCAACCCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCAAATGTTGTCCGTGGTTGGGTTTTTGGTTCTACCATGAACAACAAGTCACAGTCGGTGATTATTATTAACAATTCTACTAATGTTGTTATACGAGCATGTAACTTTGAATTGTGTGACAACCCTTTCTTTGCTGTTTCTAAACCCATGGGTACACAGACACATACTATGATATTCGATAATGCATTTAATTGCACTTTCGAGTACATATCTGATGCCTTTTCGCTTGATGTTTCAGAAAAGTCAGGTAATTTTAAACACTTACGAGAGTTTGTGTTTAAAAATAAAGATGGGTTTCTCTATGTTTATAAGGGCTATCAACCTATAGATGTAGTTCGTGATCTACCTTCTGGTTTTAACACTTTGAAACCTATTTTTAAGTTGCCTCTTGGTATTAACATTACAAATTTTAGAGCCATTCTTACAGCCTTTTCACCTGCTCAAGACATTTGGGGCACGTCAGCTGCAGCCTATTTTGTTGGCTATTTAAAGCCAACTACATTTATGCTCAAGTATGATGAAAATGGTACAATCACAGATGCTGTTGATTGTTCTCAAAATCCACTTGCTGAACTCAAATGCTCTGTTAAGAGCTTTGAGATTGACAAAGGAATTTACCAGACCTCTAATTTCAGGGTTGTTCCCTCAGGAGATGTTGTGAGATTCCCTAATATTACAAACTTGTGTCCTTTTGGAGAGGTTTTTAATGCTACTAAATTCCCTTCTGTCTATGCATGGGAGAGAAAAAAAATTTCTAATTGTGTTGCTGATTACTCTGTGCTCTACAACTCAACATTTTTTTCAACCTTTAAGTGCTATGGCGTTTCTGCCACTAAGTTGAATGATCTTTGCTTCTCCAATGTCTATGCAGATTCTTTTGTAGTCAAGGGAGATGATGTAAGACAAATAGCGCCAGGACAAACTGGTGTTATTGCTGATTATAATTATAAATTGCCAGATGATTTCATGGGTTGTGTCCTTGCTTGGAATACTAGGAACATTGATGCTACTTCAACTGGTAATTATAATTATAAATATAGGTATCTTAGACATGGCAAGCTTAGGCCCTTTGAGAGAGACATATCTAATGTGCCTTTCTCCCCTGATGGCAAACCTTGCACCCCACCTGCTCTTAATTGTTATTGGCCATTAAATGATTATGGTTTTTACACCACTACTGGCATTGGCTACCAACCTTACAGAGTTGTAGTACTTTCTTTTGAACTTTTAAATGCACCGGCCACGGTTTGTGGACCAAAATTATCCACTGACCTTATTAAGAACCAGTGTGTCAATTTTAATTTTAATGGACTCACTGGTACTGGTGTGTTAACTCCTTCTTCAAAGAGATTTCAACCATTTCAACAATTTGGCCGTGATGTTTCTGATTTCACTGATTCCGTTCGAGATCCTAAAACATCTGAAATATTAGACATTTCACCTTGCGCTTTTGGGGGTGTAAGTGTAATTACACCTGGAACAAATGCTTCATCTGAAGTTGCTGTTCTATATCAAGATGTTAACTGCACTGATGTTTCTACAGCAATTCATGCAGATCAACTCACACCAGCTTGGCGCATATATTCTACTGGAAACAATGTATTCCAGACTCAAGCAGGCTGTCTTATAGGAGCTGAGCATGTCGACACTTCTTATGAGTGCGACATTCCTATTGGAGCTGGCATTTGTGCTAGTTACCATACAGTTTCTTTATTACGTAGTACTAGCCAAAAATCTATTGTGGCTTATACTATGTCTTTAGGTGCTGATAGTTCAATTGCTTACTCTAATAACACCATTGCTATACCTACTAACTTTTCAATTAGCATTACTACAGAAGTAATGCCTGTTTCTATGGCTAAAACCTCCGTAGATTGTAATATGTACATCTGCGGAGATTCTACTGAATGTGCTAATTTGCTTCTCCAATATGGTAGCTTTTGCACACAACTAAATCGTGCACTCTCAGGTATTGCTGCTGAACAGGATCGCAACACACGTGAAGTGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAATATTTTGGTGGTTTTAATTTTTCACAAATATTACCTGACCCTCTAAAGCCAACTAAGAGGTCTTTTATTGAGGACTTGCTCTTTAATAAGGTGACACTCGCTGATGCTGGCTTCATGAAGCAATATGGCGAATGCCTAGGTGATATTAATGCTAGAGATCTCATTTGTGCGCAGAAGTTCAATGGACTTACAGTGTTGCCACCTCTGCTCACTGATGATATGATTGCTGCCTACACTGCTGCTCTAGTTAGTGGTACTGCCACTGCTGGATGGACATTTGGTGCTGGCGCTGCTCTTCAAATACCTTTTGCTATGCAAATGGCATATAGGTTCAATGGCATTGGAGTTACCCAAAATGTTCTCTATGAGAACCAAAAACAAATCGCCAACCAATTTAACAAGGCGATTAGTCAAATTCAAGAATCACTTACAACAACATCAACTGCATTGGGCAAGCTGCAAGACGTTGTTAACCAGAATGCTCAAGCATTAAACACACTTGTTAAACAACTTAGCTCTAATTTTGGTGCAATTTCAAGTGTGCTAAATGATATCCTTTCGCGACTTGATAAAGTCGAGGCGGAGGTACAAATTGACAGGTTAATTACAGGCAGACTTCAAAGCCTTCAAACCTATGTAACACAACAACTAATCAGGGCTGCTGAAATCAGGGCTTCTGCTAATCTTGCTGCTACTAAAATGTCTGAGTGTGTTCTTGGACAATCAAAAAGAGTTGACTTTTGTGGAAAGGGCTACCACCTTATGTCCTTCCCACAAGCAGCCCCGCATGGTGTTGTCTTCCTACATGTCACGTATGTGCCATCCCAGGAGAGGAACTTCACCACAGCGCCAGCAATTTGTCATGAAGGCAAAGCATACTTCCCTCGTGAAGGTGTTTTTGTGTTTAATGGCACTTCTTGGTTTATTACACAGAGGAACTTCTTTTCTCCACAAATAATTACTACAGACAATACATTTGTCTCAGGAAATTGTGATGTCGTTATTGGCATCATTAACAACACAGTTTATGATCCTCTGCAACCTGAGCTTGACTCATTCAAAGAAGAGCTGGACAAGTACTTCAAAAATCATACATCACCAGATGTTGATCTTGGCGACATTTCAGGCATTAACGCTTCTGTCGTCAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTCGCTAAAAATTTAAATGAATCACTCATTGACCTTCAAGAATTGGGAAAATATGAGCAATATATTAAATGGCCTTGGTATGTTTGGCTCGGCTTCATTGCTGGACTAATTGCCATCGTCATGGTTACAATCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAAGTTTGATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA

  • You found a bacterium that has a genome of 2 millions base pairs. How long is...

    You found a bacterium that has a genome of 2 millions base pairs. How long is the stretch of 16S rDNA that you want to sequence to make sure that you can know what specific species it is? You will first assume that there is no history in biology and then you will say in which direction the length of the DNA stretch (bigger or smaller) if you suppose that all bacterial species have evolved from a common ancestor. *

  • You found a bacterium that has a genome of 2 millions base pairs. How long is...

    You found a bacterium that has a genome of 2 millions base pairs. How long is the stretch of 16S rDNA that you want to sequence to make sure that you can know what specific species it is? You will first assume that there is no history in biology and then you will say in which direction the length of the DNA stretch (bigger or smaller) if you suppose that all bacterial species have evolved from a common ancestor.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT