How would a sequence from a GenBank record in the range, [67..1248], be represented in a...
How would a sequence from a GenBank record in the range, [67..1248], be represented in a SeqFeature object?
| 1. |
[66..1248] |
|
| 2. |
[66..1247] |
|
| 3. |
[68..1248] |
|
| 4. |
[67..1247] |
Homework Answers
Answer: [66..1248]
Explanation:
- GenBank file uses a notation which starts from 1. (One based counting)
- seqFeature object uses a notation which starts from 0. So for example 66 means it is 67th object. That is it uses -1 strand. (Zero based counting).
Add Answer to:
How would a sequence from a GenBank record in the range,
[67..1248], be represented in a...
please answer questions with the following BLAST results For your GenBank assignment due at 12 noon on Thursday May...
please answer questions with the following BLAST results
For your GenBank assignment due at 12 noon on Thursday May 23rd (don't forget, I will not accept late papers): 1. Dr. Monsen-Collar will tell you the number of a sequence posted on Canvas. Copy the entire sequence and use it in a BLAST search to determine what gene the sequence is. Answer the following questions: A. What gene is your unknown sequence likely to be? How do you know it's a...
3. Outliers: For the “Height in Inches” data, compute a z-score for each record and create...
3. Outliers: For the “Height in Inches” data, compute a z-score for each record and create a histogram of the transformed data (test different bin widths). What percentage of z-scores lie between -1 and 1? Between -2 and 2? Between -3 and 3? Do the data correspond to the expected features of a “symmetric-mound shaped distribution”? HEIGHT DATA 67 67 68 68 74 69 71 66 64 64 66 68 68 72 72 67 67 66 67 69 71...
Using Python In the decimal system (base 10), a natural number is represented as a sequence...
Using Python In the decimal system (base 10), a natural number is represented as a sequence dndn?1 . . . d0 of (decimal) digits, each of which is in the range 0..9. The value of the number is d0 ×100 +d1 ×101 +···+ dn ×10n. Similarly, in the binary system (base 2), a natural number is represented as a sequence bnbn?1 · · · b0 of (binary) digits, each of which is 0 or 1. The value of the number...
Question three The results in Management examinations at ICU were as shown below: 63 65 67...
Question three The results in Management examinations at ICU were as shown below: 63 65 67 68 69 70 71 72 74 75 x If the mean of this data is 69 Calculate: The value of x (2 marks) Interquartile range (4 marks) The intelligence of student was measured and using the ranking of 5 as excellent, 4 Very good, 3 Good 2 Average and 1 below average The table below shows distribution of intelligence with grades: Grades 63 65...
2. State the limit of the sequence represented by each graph, if it exists. If it...
2. State the limit of the sequence represented by each graph, if it exists. If it does not exist, explain why. a) b) c) S 7+ 10 8 6 4 2 4 4 . 2 . 1 2 3 4 5 6 7 8 9 3 2 2 4 0 2 4 6 8 6 1 -8 10 1 0 2 4 6 8 PI
CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from...
CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from it? 2. How many reading frames are in that mRNA? 3. How many open reading frames are in that mRNA and what is it/are they? 4. Translate the open reading frame(s).
Please help! I would really appreciate it. (20 points) You have the following sequence of numbers:...
Please help! I would really appreciate it.
(20 points) You have the following sequence of numbers: 1, 2, 4, 7, 11, 16, 22, 29, 37, 46, 56, 67, 79, 92, Find the recursive rule from the above series, and give a recursive definition, and write a function that implements the definition. (Note: f(1) - 1, f(2 ) -2. f (3) 4. f(4) 7,...)
Answer for this question plz Q1. a. Show how the decimal number (-120) will be represented...
Answer for this question plz
Q1. a. Show how the decimal number (-120) will be represented in the computer using THREE methods of 8-bit negative number representation. [3 Marks) b. Show how the real number 5308.75 will be represented in the computer using IEEE floating point format [2 marks] C. We want to design a circuit to detect the input sequence 11101 from a sequence of bits with accepted overlapped sequences. The circuit has a single bit input x and...
How many peptide fragments would result from cleaving the sequence with...
A protein has the amino acid sequence:DSRLSKTMYSIEAPAKLDWEQNMALHow many peptide fragments would result from cleaving the sequence with....a: cyanogen bromideb: trypsinc: Which of these reagents gives the smallest single fragment (in number of amino acid residues)?Please explain how to work out this problem. Thanks!
West Battery Corp. has recently been receiving complaints from retailers that its 9-volt batteries are not...
West Battery Corp. has recently been receiving complaints from retailers that its 9-volt batteries are not lasting as long as other name brands. James West, head of the TOM program at West's Austin plant, believes there is no problem because his batteries have had an average life of 60 hours, about 10% longer than competitors' models. To raise the time above this level would require a new level of technology not available to West. Nevertheless, he is concerned enough to...
please answer questions with the following BLAST results
For your GenBank assignment due at 12 noon on Thursday May 23rd (don't forget, I will not accept late papers): 1. Dr. Monsen-Collar will tell you the number of a sequence posted on Canvas. Copy the entire sequence and use it in a BLAST search to determine what gene the sequence is. Answer the following questions: A. What gene is your unknown sequence likely to be? How do you know it's a...
2. State the limit of the sequence represented by each graph, if it exists. If it does not exist, explain why. a) b) c) S 7+ 10 8 6 4 2 4 4 . 2 . 1 2 3 4 5 6 7 8 9 3 2 2 4 0 2 4 6 8 6 1 -8 10 1 0 2 4 6 8 PI
CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from it? 2. How many reading frames are in that mRNA? 3. How many open reading frames are in that mRNA and what is it/are they? 4. Translate the open reading frame(s).
Please help! I would really appreciate it.
(20 points) You have the following sequence of numbers: 1, 2, 4, 7, 11, 16, 22, 29, 37, 46, 56, 67, 79, 92, Find the recursive rule from the above series, and give a recursive definition, and write a function that implements the definition. (Note: f(1) - 1, f(2 ) -2. f (3) 4. f(4) 7,...)
Answer for this question plz
Q1. a. Show how the decimal number (-120) will be represented in the computer using THREE methods of 8-bit negative number representation. [3 Marks) b. Show how the real number 5308.75 will be represented in the computer using IEEE floating point format [2 marks] C. We want to design a circuit to detect the input sequence 11101 from a sequence of bits with accepted overlapped sequences. The circuit has a single bit input x and...
West Battery Corp. has recently been receiving complaints from retailers that its 9-volt batteries are not lasting as long as other name brands. James West, head of the TOM program at West's Austin plant, believes there is no problem because his batteries have had an average life of 60 hours, about 10% longer than competitors' models. To raise the time above this level would require a new level of technology not available to West. Nevertheless, he is concerned enough to...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago