Question



CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from it? 2. How many read
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Dear Student answer to your question is given below:

Question No 1.

Coding strand: CACTATGCCGGTAAGGTTCCCATGACC

mRNA strand: GUGAUACGGCCAUUCCAAGGGUACUGG

Explanation: Since DNA has two strands, one is non-coding strand and other is Coding Strand. So if there is Coding Strand given, then I can write non coding strand of it by using Complimentarity and from that I can write mRNA sequence which will be same as Non- Coding Strand except in place of thymine there will be Uracil base.

Add a comment
Know the answer?
Add Answer to:
CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 4. Given the following information: One strand of a section of DNA isolated from E. coli...

    4. Given the following information: One strand of a section of DNA isolated from E. coli reads                                     5’-GTAGCCTACCCATAGG-3’                                     3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...

  • 7. Open reading frames A protein coding gene includes the following sequence on one of its...

    7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...

  • One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA...

    One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...

  • One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’

    One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ (a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? (b) What is the amino acid sequence of the proteins. (c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. (d) If the T underlined in the above sequence was to...

  • The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its...

    The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its reading frame is set and it can be seen in the middle of the gene sequence. Write out its mRNA strand sequence.

  • #8 . Metro by T-Mobile LTE 10:40 PM 69% Done 9 of 9 Is coding strand...

    #8 . Metro by T-Mobile LTE 10:40 PM 69% Done 9 of 9 Is coding strand so assume both could be the coding strand 5' - GCTAATGCACOTT - 3 3' - OGATTACGTGCAA - 5 5-CGALUAC GUGCAA - 3 3-GCUAAUGCACGUU - 5 As opposed to DNA replication or transcription, translation requires the correct reading frame. a) Use the sequence below to illustrate what the reading frame" on an mRNA refers to 5' UUGCAYUGSAGC 3' b) Write out ALL of the possible...

  • You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and...

    You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence

  • Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...

    Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005

  • PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the...

    PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the answers below. (Select more than 1 answer) The coding strand is the first strand running from 5' to 3'. The coding strand is the second strand running from 3' to 5'. The template strand is the second strand running from 3' to 5'. The template strand is the first strand running from 5' to 3'. 2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...

  • 6/q /4925530/take REFEBERHETERRE AGAGGGGTTACCGGGGATTGTAGACTTCTCS a) Using the DNA sequence provided (note: only the coding strand is...

    6/q /4925530/take REFEBERHETERRE AGAGGGGTTACCGGGGATTGTAGACTTCTCS a) Using the DNA sequence provided (note: only the coding strand is provided) transcribe the sequence into mRNA. Assume transcription starts at the first nucleotide of the provided sequence that is, the promoter region is not shown). b) Translate the mRNA strand from part a to the correct amino acid sequence The codon chart is provided BIANIE BSN

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT