Homework Answers
The possible mRNA strands and its open reading frames ( 3 each) for the given gene sequence are given in the image. Since it is given in the question that, five of the six potential reading frames in this region include stops, only the true reading frame remains "open" through this segment, we can conclude the open reading frame of the protein is,
Phe- Ser- Gln- Leu- Leu- Gly
a) Coding strand is the one which has nucleotide sequence same as the mRNA.
Hence the given DNA strand 5'-CCTAGCAGTTGACTAAAGT -3' is the coding strand of the
mRNA 5'- ACUUUAGUCAACUGCUAGG -3'
b) The aminoacid sequence of the given protein is mentioned above. From that we can understand that the same aminoacid comes adjacent in the gene segment is Leucine (with codons CUG and CUA)
Add Answer to:
7. Open reading frames A protein coding gene includes the following sequence on one of its...
3. Translation. According to the rules of the genetic code, there are six different reading frames...
3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...
Consider the following segment of DNA is part of a gene,
Consider the following segment of DNA is part of a gene, Left 5'.... ACTGACTGACAGTC..3' 3'.... TGACTGACTGTCAG... 5' RIGHT during RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please predict the peptide sequence(s) produced from the mRNA transcribed from this segment of DNA. (Hint: First determine the mRNA sequence, then use the genetic codon table to...
genetics i need help woth good details How many possible open reading frames (frames without stop...
genetics i need help woth good details
How many possible open reading frames (frames without stop codons) exist that extend through the following sequence? Note: since this is a partial sequence, do not consider start codons when looking for open reading frames. (STOP CODONS = UAA, UAG, UGA) 5 -----CTTACAGTTTATTGATACGGAGAAGG----3' 3'-----GAATGTCAAATAACTATGCCTCTTCC-----5' HTML Editora
The following is a small stretch of DNA sequence from middle of a bacterial open reading...
The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length : 5’-GCCTACTCTATGTTTACATCTGTGCTACGC – 3’ 3’-CGGATGAGATACAAATGTAGACACGATGCG – 5’ A) Which of the strands is the template strand for the mRNA that is transcribed from this DNA (“top strand” 5’ to 3’ left to right or “bottom strand” 5’ to 3’ right to left)? B) What is the basis for your answer to part...
The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its...
The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its reading frame is set and it can be seen in the middle of the gene sequence. Write out its mRNA strand sequence.
QUESTION 7 Consider the hypothetical gene show here. The gene coding sequence consists of 4 exons...
QUESTION 7 Consider the hypothetical gene show here. The gene coding sequence consists of 4 exons (shown in solid colors). The 5' UTR and 3' UTR are shown as striped boxes. 25 150 200 300 400 25 Based on the lengths of the exons, you should be able to calculate a rough estimate of the protein encoded by this gene, assuming that all 4 exons are translated and the protein does not undergo any significant processing (cleavage or chemical modifications)....
If in fact this small sequence derives from somewhere in the middle of a CDS, then...
If in fact this small sequence derives from somewhere in the
middle of a CDS, then the coding strand (AKA, "sense"
strand) must be the one which is written in ____ font
Once the open reading frame has been identified, the 23
nucleotides of the coding strand above can be translated into seven
complete codons plus two nucleotides which comprise parts of some
unknown codon(s). Ignoring the two extra nucleotides, the
first* complete in-frame codon in this short chain of...
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This...
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...
4. Given the following information: One strand of a section of DNA isolated from E. coli...
4. Given the following information: One strand of a section of DNA isolated from E. coli reads 5’-GTAGCCTACCCATAGG-3’ 3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...
where does transcription begin 3. List the major types of RNA and include what they code...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...
genetics i need help woth good details
How many possible open reading frames (frames without stop codons) exist that extend through the following sequence? Note: since this is a partial sequence, do not consider start codons when looking for open reading frames. (STOP CODONS = UAA, UAG, UGA) 5 -----CTTACAGTTTATTGATACGGAGAAGG----3' 3'-----GAATGTCAAATAACTATGCCTCTTCC-----5' HTML Editora
QUESTION 7 Consider the hypothetical gene show here. The gene coding sequence consists of 4 exons (shown in solid colors). The 5' UTR and 3' UTR are shown as striped boxes. 25 150 200 300 400 25 Based on the lengths of the exons, you should be able to calculate a rough estimate of the protein encoded by this gene, assuming that all 4 exons are translated and the protein does not undergo any significant processing (cleavage or chemical modifications)....
If in fact this small sequence derives from somewhere in the
middle of a CDS, then the coding strand (AKA, "sense"
strand) must be the one which is written in ____ font
Once the open reading frame has been identified, the 23
nucleotides of the coding strand above can be translated into seven
complete codons plus two nucleotides which comprise parts of some
unknown codon(s). Ignoring the two extra nucleotides, the
first* complete in-frame codon in this short chain of...
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago