Question

5...ATCTAAGTGAGATCATATAGGAC...3 ELVOLLIVOLOLVOLVL LOOL,9 flipped by 180°, this sequence also reads: 5...GTCCTATATGATCTCACT

If in fact this small sequence derives from somewhere in the middle of a CDS, then the coding strand (AKA, "sense" strand) must be the one which is written in ____ font

Once the open reading frame has been identified, the 23 nucleotides of the coding strand above can be translated into seven complete codons plus two nucleotides which comprise parts of some unknown codon(s). Ignoring the two extra nucleotides, the first* complete in-frame codon in this short chain of 7 amino acids encodes the amino acid, ____

0 0
Add a comment Improve this question Transcribed image text
Answer #1

S ATcТААСТСААТСАТАТА G6Ac - 3 Q! TAG Аттс Астс TAGTA т Атест G-s. flipped by 1800- s GTccТАТАТАTeтc AcTTAGATз а с Ass АТАТАс

Add a comment
Know the answer?
Add Answer to:
If in fact this small sequence derives from somewhere in the middle of a CDS, then...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The following is a small stretch of DNA sequence from middle of a bacterial open reading...

    The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length :      5’-GCCTACTCTATGTTTACATCTGTGCTACGC – 3’      3’-CGGATGAGATACAAATGTAGACACGATGCG – 5’ A) Which of the strands is the template strand for the mRNA that is transcribed from this DNA (“top strand” 5’ to 3’ left to right or “bottom strand” 5’ to 3’ right to left)? B) What is the basis for your answer to part...

  • 4. The following is a small stretch of DNA sequence from middle of a bacterial open...

    4. The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length: 5 «асстлcтстAтстттАСАТcтaтacтлсос - 3 3-CGGATGAGATACAAATGTAGACACGATGCG - 5' A. Which of the strands is the template strand for the mRNA that is transcribed from this DNA ("top strand" 5' 3' left to right or "bottom strand' 5 3 ' right to left)? B. What is the basis for your answer to part...

  • Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence fil...

    Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence file (alternatively you can use the getRandomSeq(long) method of the RandomSeq class to generate a piece of DNA sequence), and then print out all the codons in three forward reading frames. Design a method called codon() that can be used to find all the codons from three reading frames. The method will take in an argument, the reading frame (1, 2, or...

  • Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in...

    Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in the third nucleotide position? 2. Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code C. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon 8. Nonsense codon h. Universal code i. Nonuniversal code 3. What role do the initiation factors play in protein synthesis? 4. Compare and contrast the process of protein synthesis in...

  • QUESTION 7 Consider the hypothetical gene show here. The gene coding sequence consists of 4 exons...

    QUESTION 7 Consider the hypothetical gene show here. The gene coding sequence consists of 4 exons (shown in solid colors). The 5' UTR and 3' UTR are shown as striped boxes. 25 150 200 300 400 25 Based on the lengths of the exons, you should be able to calculate a rough estimate of the protein encoded by this gene, assuming that all 4 exons are translated and the protein does not undergo any significant processing (cleavage or chemical modifications)....

  • tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcg

    tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct Your job now is to copy the above DNA sequence and highlight each of the different sequence elements that are relevant to this particular gene (I suggest that you use different font backgrounds for each sequence element) and briefly explain what each of them do . Then, write the sequence of the mRNA that would be transcribed from this DNA sequence, identifying the AUG and STOP codon (I suggest that you bold and underline text this time). Once you've...

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • based on the given graph how would these be answered? sa sequence from a sheep PCR...

    based on the given graph how would these be answered? sa sequence from a sheep PCR product. The template used was genomic DNA and the forward and se primers were designed to amplify partofthe priongene, which encodes the causative agentot scrapie. is black;Cisblue; Ais green: Tisred. The forward primerwasusedasasequencing primer. TheNattheten ow means that the computer can't decide which nucleotide is at that position in the sequence because there are two peaks (red=T and blue-C) that are the same height....

  • Complete the following table and answer the next two questions (3.5 marts) 10 B I =...

    Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...

  • DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...

    DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT