Question

The following is a small stretch of DNA sequence from middle of a bacterial open reading...

  1. The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length :

     5’-GCCTACTCTATGTTTACATCTGTGCTACGC – 3’

     3’-CGGATGAGATACAAATGTAGACACGATGCG – 5’

A) Which of the strands is the template strand for the mRNA that is transcribed from this DNA (“top strand” 5’ to 3’ left to right or “bottom strand” 5’ to 3’ right to left)?

B) What is the basis for your answer to part A?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

A) “bottom strand” 5’ to 3’ right to left

B)

For protein synthesis, DNA must first be copied to messenger ribonucleic acid, or mRNA. This process is called transcription. The mRNA holds the coding information to make proteins. Unlike DNA, RNA is single-stranded and not helical in shape. It contains ribose instead of deoxyribose, and its nucleotide bases differ by having uracil (U) instead of thymine (T).

Initially, the enzyme RNA polymerase must assemble the pre-mRNA molecule that complements a section of one DNA’s two strands. Since the goal is not replication but protein synthesis, only one strand of DNA needs copying. The RNA polymerase first attaches to the double helix of DNA and works with proteins called transcription factors to determine what information needs transcribing. The RNA polymerase and transcription factors bind to this DNA strand, called the template strand.

The unit of RNA polymerase and transcription factors moves along the strand in a 3’ to 5’ (3 prime to 5 prime) direction OR (5’ TO 3’ RIGHT TO LEFT)and makes a new strand of mRNA with complementary base pairs. RNA polymerase builds the mRNA with additional nucleotides in elongation. The complementary nucleotides in mRNA, however, differ from DNA in that uracil replaces thymine. The mRNA runs in a 5’ to 3’ (5 prime to 3 prime) direction. After elongation ceases, mRNA separates from the DNA template strand in termination. Then mRNA serves either in a role of messenger in the cell, or it is used in protein formation, or translation

Add a comment
Know the answer?
Add Answer to:
The following is a small stretch of DNA sequence from middle of a bacterial open reading...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 4. The following is a small stretch of DNA sequence from middle of a bacterial open...

    4. The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length: 5 «асстлcтстAтстттАСАТcтaтacтлсос - 3 3-CGGATGAGATACAAATGTAGACACGATGCG - 5' A. Which of the strands is the template strand for the mRNA that is transcribed from this DNA ("top strand" 5' 3' left to right or "bottom strand' 5 3 ' right to left)? B. What is the basis for your answer to part...

  • This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.

    This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right    Right to Left Lagging to Leading    A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...

  • 4. Given the following information: One strand of a section of DNA isolated from E. coli...

    4. Given the following information: One strand of a section of DNA isolated from E. coli reads                                     5’-GTAGCCTACCCATAGG-3’                                     3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...

  • The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...

    The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...

  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • If in fact this small sequence derives from somewhere in the middle of a CDS, then...

    If in fact this small sequence derives from somewhere in the middle of a CDS, then the coding strand (AKA, "sense" strand) must be the one which is written in ____ font Once the open reading frame has been identified, the 23 nucleotides of the coding strand above can be translated into seven complete codons plus two nucleotides which comprise parts of some unknown codon(s). Ignoring the two extra nucleotides, the first* complete in-frame codon in this short chain of...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • 3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

    3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

  • The DNA sequence shown encodes the last amino acids of a protein that has a total...

    The DNA sequence shown encodes the last amino acids of a protein that has a total of 270 amino acids. The bolded base pairs indicate the translation reading frame. 5’ …….GCT AAG TAT TGC TCA AGA TTA GGA TGA TAA ATA ACT TGG 3’ 3’ …….CGA TTA ATA ACG AGT TCT AAT CCT ACT ATT TAT TGA ACC 5’ Which is the template strand for transcription? Explain.

  • 1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...

    1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT