1) The 5'-end of an mRNA has the sequence:
...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG...
What is the nucleotide sequence of the DNA template strand from which it was transcribed?
2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?


Unca 11 Answer :- The 5-end of an on RNA
has the sequence- GUECA VUG AUG CAU GAAUCAUAUGQC A GA GECCGCUGG -
The nucleotide sequence of the DNA template strand from which it
was transcribed is - CAGGTAACTACGTACTTAGTATECGTCT2999 Cgace N 21
Answer :- If the mRNA is translated beginning with the first AUG
codon in its sequence, then the codon will encode for the amino
acid methionine.
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
A portion of the template strand of DNA has the following sequence: 5' ATA GCG TTC CAC CGC 3'. Assume the first codon for the peptide begins with the first nucleotide of the portion of mRNA and there are no introns (May not start at AUG). Enter the mRNA and amino acid sequence below
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
1 e
and 2 e 1 need help on those. ive posted this multiple times and
peolle have anawered . but both times i posted they have given me
two diff reaponses for the answers. please help for 1e and 2e. if u
coild look at the chart and decide the sequences for me
please be simple and clear
3rd base in codon puco sucopucobuco 2nd base in codon CAIG SS2288 222222233&a The Genetic Code 1st base in codon Norma...
1.) In which direction is RNA transcribed?
2.) Which of the two strands (A or B) serves as the TEMPLATE
strand for the transcription of a mRNA that contains both a start
and a stop codon?
3.) Which number (1, 2, 3, 4, or 5) best approximates the
location of the -10 consensus sequence?
4.) How many amino acids long is the protein encoded by the mRNA
from this DNA sequence?
5.) What is the second...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
Question 16: The following shows the same segment of DNA that was shown above in Question 15, however, this DNA sequence is for the mutant allele for the collagen type 1 gene. This mutated allele is responsible for a genetic skeletal disorder called osteogenesis imperfecta. 5' ATGCTATGGGCATGATCCCAGCCT 3' 3' TACGATACCCGTACTAGGGTCGGA 5' Answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele? The mutated mRNA...
7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...