Question

Can I get help in making a small program in python implementing the Brute force motif...

Can I get help in making a small program in python implementing the Brute force motif search algorithm?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Brute_Force_Motif_Search(Dna,k)-Every possibility of  k-mers Motifs from Dna.

Code-

def BruteForce(Dna, k): # function definition with parameter Dna and k-mers Motifs
occurrences = []
for i in range(len(Dna)-len(k)+1): # loop over alignment
match = True
for j in range(len(k)): # loop over characters
if Dna[i+j] != k[j]: # compare characters
match = False # mismatch
break
if match: # allchars matched
occurrences.append(i)

print(occurrences)
k = input("Enter k-mers Motifs: ")
Dna = input("Enter Dna sequence: ")
BruteForce(Dna, k)

Output-

Enter k-mers Motifs: AGAGA

Enter Dna sequence: AGATAGAGAGATAGAGAGATAGAGAGATAGAGAGATAGAG
[4, 6, 12, 14, 20, 22, 28, 30]

Output-

Add a comment
Know the answer?
Add Answer to:
Can I get help in making a small program in python implementing the Brute force motif...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Write programm in C or C# : Write a program in C# to compare between the...

    Write programm in C or C# : Write a program in C# to compare between the brute-force and median string algorithms to solve the problem of motif finding. Your program will read the DNA from a text file (one line for a sequence) and the user enters the length of the motif (I). Your program should show S=(s1, s2...st) and the time is taken by each algorithm.

  • python Hi guys, I really need help with that please Can I get help with this...

    python Hi guys, I really need help with that please Can I get help with this python program? Please write clear Show all the steps please, the outcome and follow the directions. Volume # Purpose: This program computes the volume (in liters) of a six-pack of soda cans and the total volume of a six-pack and a two-liter bottle. Complete the following: # Liters in a 12-ounce can and a two-liter bottle. # Number of cans per pack. # Calculate...

  • Writing in Python. Need help making this program: Hanoi's tower is an old game that can...

    Writing in Python. Need help making this program: Hanoi's tower is an old game that can be solved with a recursive algorithm. Wikipedia contains example implementations of this. You will write a variant of this implementation that prints the condition of the three stacks of slices after each move. Remember that the different recursive calls will refer to different stacks, so in order to print a status that is comparable between calls, the method that prints the stacks must have...

  • Program by force brute in (c++ or java language )

    The question of validity is to answer the question of whether for a Boolean expression consisting of n variables . There is a combination of values of variables that make the result of the expression true or not. In this phrase each The variable can be simple or contradictory. Force brute method of all compounds . Creates and evaluates the possible and the first time the result is true (if it is) the answer to the problem Come and stop...

  • 5) Which of the following is/are true? (2pts) I) a brute force algorithm will always give...

    5) Which of the following is/are true? (2pts) I) a brute force algorithm will always give you the optimal solution Il) since greedy algorithms make locally optimal choices, they are always guaranteed to find the best possible solution to an optimization problem IlI) brute-force solutions generally run slower than greedy algorithms a) I and lIl b)1 and IlI c) Il and III d) Ill only e) I, I and llI

  • Can I get help with implementing a quick sort in my program? Starter Code: import java.util.Random;...

    Can I get help with implementing a quick sort in my program? Starter Code: import java.util.Random; import java.util.Scanner; import java.util.Arrays; import java.util.Collections; import java.util.ArrayList; public class RQS { public static int[] prepareData(int[] patients){ /* Data is prepared by inserting random values between 1 and 1000. Data items may be assumed to be unique. Please refer to lab spec for the problem definiton. */ // what is our range? int max = 1000; // create instance of Random class Random randomNum...

  • Making a Secret Santa I need a Python program that does the following: 1 - You...

    Making a Secret Santa I need a Python program that does the following: 1 - You can input the amount of people being entered into the Secret Santa 2 - Person1 does not get Person2, and vis versa. 3 - Person3 does not get Person4, and vis versa. 4 - Person5 does not get Person6, and vis versa. 5 - Person7 does not get Person8, and vis versa. 6 - When the random selection with the above conditions are complete,...

  • python code,please! Task 3:N ns Brute For In mathematics, the notion of permutation relates to the act of arranging all the members of a set into some sequence or order, or if the set is already or...

    python code,please! Task 3:N ns Brute For In mathematics, the notion of permutation relates to the act of arranging all the members of a set into some sequence or order, or if the set is already ordered, rearranging (reordering) its elements, a process called permuting. The number of permutations on a set of n elements is given by n! (Read as n factorial). For example, there are 2!2 x 1- 2 permutations of 11,2), 2,1) and 3!-3x2x16 permutations of (1,2,3),...

  • Please help. I need to write a Python program that can display which axis is aligned...

    Please help. I need to write a Python program that can display which axis is aligned with gravity based on Accelerometer readings. This is for a quadcopter drone if that helps.

  • Please can someone help me with making this program in JAVA implementing classes. Also, include loops...

    Please can someone help me with making this program in JAVA implementing classes. Also, include loops and selection structures. A mobile service provider has three different subscription packages for its customers: Package A: For $50 per month, 5 GB data are provided. Additional data is $15 per GB. Package B: For $65 per month, 10 data are provided. Additional data is $10 per GB. Package C: For $75 per month unlimited data provided. Text messaging and voice services are included...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT